FAM127A-family with sequence similarity 127, member A Gene View larger

FAM127A-family with sequence similarity 127, member A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM127A-family with sequence similarity 127, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM127A-family with sequence similarity 127, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002385
Product type: DNA & cDNA
Ncbi symbol: FAM127A
Origin species: Human
Product name: FAM127A-family with sequence similarity 127, member A Gene
Size: 2ug
Accessions: BC002385
Gene id: 8933
Gene description: family with sequence similarity 127, member A
Synonyms: protein FAM127A; CXX1; MAR8C; MART8C; Mar8; Mart8; CAAX box 1; mammalian retrotransposon derived protein 8C; family with sequence similarity 127 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggtcgggtgcagctgataaaggccctcctggccttgccgatccggcctgcgacgcgtcgctggaggaacccgattccctttcccgagacgtttgacggcgataccgaccgactcccggagttcatcgtgcagacgggctcctacatgttcgtggacgagaacacgttctccagcgacgccctgaaggtgacgttcctcatcacccgcctcacagggcccgccctgcagtgggtgatcccctacatcaagaaggagagccccctcctcaatgattaccggggctttctggccgagatgaagcgagtctttggatgggaggaggacgaggacttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 136, member A
- family with sequence similarity 176, member A
- ubiquitin-conjugating enzyme E2A (RAD6 homolog)
- growth arrest and DNA-damage-inducible, alpha

Buy FAM127A-family with sequence similarity 127, member A Gene now

Add to cart