Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003612 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP1M2 |
| Origin species: | Human |
| Product name: | AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene |
| Size: | 2ug |
| Accessions: | BC003612 |
| Gene id: | 10053 |
| Gene description: | adaptor-related protein complex 1, mu 2 subunit |
| Synonyms: | AP1-mu2; HSMU1B; MU-1B; MU1B; mu2; AP-1 complex subunit mu-2; AP-mu chain family member mu1B; HA1 47 kDa subunit 2; adaptor protein complex AP-1 mu-2 subunit; clathrin assembly protein complex 1 mu-2 medium chain 2; clathrin coat assembly protein AP47 2; clathrin coat associated protein AP47 2; clathrin-associated adaptor medium chain mu2; golgi adaptor AP-1 47 kDa protein; golgi adaptor HA1/AP1 adaptin mu-2 subunit; mu-adaptin 2; mu1B-adaptin; adaptor related protein complex 1 mu 2 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgcctcggctgtcttcattctggacgttaagggcaagccattgatcagccgcaactacaagggcgatgtggccatgagcaagattgagcacttcatgcctttgctggtacagcgggaggaggaaggcgccctggccccgctgctgagccacggccaggtccacttcctatggatcaaacacagcaacctctacttggtggccaccacatcgaagaatgccaatgcctccctggtgtactccttcctgtataagacaatagaggtattctgcgaatacttcaaggagctggaggaggagagcatccgggacaactttgtcatcgtctacgagttgctggacgagctcatggactttggcttcccgcagaccaccgacagcaagatcctgcaggagtacatcactcagcagagcaacaagctggagacgggcaagtcacgggtgccacccactgtcaccaacgctgtgtcctggcgctccgagggtatcaagtataagaagaacgaggtcttcattgatgtcatagagtctgtcaacctgctggtcaatgccaacggcagcgtccttctgagcgaaatcgtcggtaccatcaagctcaaggtgtttctgtcaggaatgccagagctgcggctgggcctcaatgaccgcgtgctcttcgagctcactggccgcagcaagaacaaatcagtagagctggaggatgtaaaattccaccagtgcgtgcggctctctcgctttgacaacgaccgcaccatctccttcatcccgcctgatggtgactttgagctcatgtcataccgcctcagcacccaggtcaagccactgatctggattgagtctgtcattgagaagttctcccacagccgcgtggagatcatggtcaaggccaaggggcagtttaagaaacagtcagtggccaacggtgtggagatatctgtgcctgtacccagcgatgccgactcccccagattcaagaccagtgtgggcagcgccaagtatgtgccggagagaaacgtcgtgatttggagtattaagtctttcccggggggcaaggagtacttgatgcgagcccactttggcctccccagtgtggaaaaggaagaggtggagggccggccccccatcggggtcaagtttgagatcccctacttcaccgtctctgggatccaggtccgatacatgaagatcattgagaaaagtggttaccaggccctgccctgggttcgctacatcacccagagtggcgattaccaacttcgtaccagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adaptor-related protein complex 2, mu 1 subunit - transforming growth factor, beta-induced, 68kDa - acyl-CoA synthetase short-chain family member 3 - leucine-rich repeats and death domain containing |