FAM118B-family with sequence similarity 118, member B Gene View larger

FAM118B-family with sequence similarity 118, member B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM118B-family with sequence similarity 118, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM118B-family with sequence similarity 118, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001340
Product type: DNA & cDNA
Ncbi symbol: FAM118B
Origin species: Human
Product name: FAM118B-family with sequence similarity 118, member B Gene
Size: 2ug
Accessions: BC001340
Gene id: 79607
Gene description: family with sequence similarity 118, member B
Synonyms: protein FAM118B; family with sequence similarity 118 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttctacagggagccaggcctctgatatagacgagatttttggattcttcaacgatggcgaacctcccaccaaaaagcccaggaagctgcttccaagcttaaaaactaagaagcctcgagaacttgtgctagtgattggaacaggcattagtgctgcagttgcgccccaagttccagccctcaaatcctggaaggggttaattcaggccttactggatgctgccattgattttgatcttttagaagatgaggagagcaaaaagtttcagaaatgtctccatgaagacaagaacctggtccatgttgcccatgaccttatccagaaactctctcctcgtaccagtaatgttcgatccacatttttcaaggactgtttatatgaagtatttgatgacttggagtcaaagatggaagattctggaaaacagctacttcagtcagttctccacctgatggaaaatggagccctcgtattaactacaaattttgataatctcttggaactgtatgcagcagatcaggggaaacagcttgaatcccttgaccttactgatgagaaaaaggtcctcgagtgggctcaggagaagcgtaagctgagcgtgttgcatattcacggagtctacaccaaccctagtggcattgtccttcatccggctggatatcagaacgtgctcaggaacactgaagtcatgagagaaattcagaaactctacgaaaacaagtcatttcttttcctgggctgtggctggactgtggatgacaccactttccaggcccttttcttggaggctgtcaagcataaatctgacctagaacatttcatgctggttcggagaggagacgtagatgagttcaaaaagcttcgagaaaacatgctggacaaggggattaaagtcatctcctatggagatgactatgccgatcttccagaatatttcaagcgactgacatgtgagatctccacaaggggtacatcagcagggatggtgagagaaggtcagctaaatggctcatctgcagcacacagtgaaataagaggctgtagtacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - minichromosome maintenance complex component 10
- family with sequence similarity 105, member A
- chitinase 3-like 1 (cartilage glycoprotein-39)
- REX4, RNA exonuclease 4 homolog (S. cerevisiae)

Buy FAM118B-family with sequence similarity 118, member B Gene now

Add to cart