MCM10-minichromosome maintenance complex component 10 Gene View larger

MCM10-minichromosome maintenance complex component 10 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCM10-minichromosome maintenance complex component 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MCM10-minichromosome maintenance complex component 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009108
Product type: DNA & cDNA
Ncbi symbol: MCM10
Origin species: Human
Product name: MCM10-minichromosome maintenance complex component 10 Gene
Size: 2ug
Accessions: BC009108
Gene id: 55388
Gene description: minichromosome maintenance complex component 10
Synonyms: homolog of yeast MCM10; MCM10 minichromosome maintenance deficient 10; protein MCM10 homolog; CNA43; DNA43; PRO2249; hsMCM10; minichromosome maintenance complex component 10; minichromosome maintenance 10 replication initiation factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctgccgacgtgtggagccaggaacttaaaacaacatttagccaaagcctcagcttcagggattatggggagcccaaaaccagccatcaagtccatctcggcctcagcactcttgaagcaacagaagcagcggatgttggagatgaggagaaggaaatcagaagaaatacagaagcgatttctgcagagctcaagtgaagttgagagcccagctgtgccatcttcatcaagacagccccctgctcagcctccacggacaggatccgagttccccaggctggagggagccccggccacaatgacgcccaagctggggcgaggtgtcttggaaggagatgatgttctcttttatgatgagtcaccaccaccaagaccaaaactgagtgctttagcagaagccaaaaagttagctgctatcaccaaattaagggcaaaaggccaggttcttacaaaaacaaacccaaacagcattaagaagaaacaaaaggaccctcaggacatcctggaggtgaaggaacgtgtagaaaaaaacaccatgttttcttctcaagctgaggatgaattggagcctgccaggaaaaaaaggagagaacaacttgcctatctggaatctgaggaatttcagaaaatcctaaaagcaaaatcaaaacacacaggcatcctgaaagaggccgaggctgagatgcaggagcgctactttgagccactggtgaaaaaagaacaaatggaagaaaagatgagaaacatcagagaagtgaagtgccgtgtcgtgacatgcaagacgtgcgcctatacccacttcaagctgctggagacctgcgtcagtgagcagcatgaataccactggcatgatggtgtgaagaggtttttcaaatgtccctgtggaaacagaagcatctccttggacagactcccgaacaagcactgcagtaactgtggcctctacaaatgggaacgggacggaatgctaaaggaaaagactggtccaaagataggaggagaaactctgttaccaagaggagaagaacatgctaaatttctgaacagccttaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 105, member A
- chitinase 3-like 1 (cartilage glycoprotein-39)
- REX4, RNA exonuclease 4 homolog (S. cerevisiae)
- adaptor-related protein complex 1, mu 2 subunit

Buy MCM10-minichromosome maintenance complex component 10 Gene now

Add to cart