PARP11-poly (ADP-ribose) polymerase family, member 11 Gene View larger

PARP11-poly (ADP-ribose) polymerase family, member 11 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARP11-poly (ADP-ribose) polymerase family, member 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PARP11-poly (ADP-ribose) polymerase family, member 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017569
Product type: DNA & cDNA
Ncbi symbol: PARP11
Origin species: Human
Product name: PARP11-poly (ADP-ribose) polymerase family, member 11 Gene
Size: 2ug
Accessions: BC017569
Gene id: 57097
Gene description: poly (ADP-ribose) polymerase family, member 11
Synonyms: ARTD11; C12orf6; MIB006; poly [ADP-ribose] polymerase 11; ADP-ribosyltransferase diphtheria toxin-like 11; poly(ADP-ribose) polymerase family member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcacaaagcagaagaattattttctaaaacaacaaacaatgaagtggatgacatggacacgtcagatacccagtggggctggttttacttggcagaatgtgggaagtggcacatgtttcagccggataccaacagtcagtgttcagttagcagtgaagatatcgaaaaaagcttcaaaacaaacccttgtggctccatttcttttactacttccaaattcagctacaagatagactttgcagaaatgaagcaaatgaatctcaccactggaaagcagcgcttaataaaaagagcccccttttctatcagtgctttcagttacatctgtgaaaacgaggccatccctatgccaccacactgggagaatgtgaatactcaagtaccatatcagcttattcctctgcacaatcaaacacatgaatataatgaagttgctaatctctttgggaagacgatggatcgcaaccgaattaaaagaattcagagaattcaaaacctagatttgtgggagttcttttgcaggaaaaaggctcagctcaagaaaaaaagaggtgtgcctcagattaatgaacaaatgctgtttcatggtaccagcagtgaatttgtggaagcaatctgcattcataactttgattggagaataaatggtatacatggtgctgtctttggaaaaggaacctattttgctagagatgctgcttattccagtcgtttctgcaaagatgacataaagcatgggaacacattccaaattcatggtgtcagcttgcaacagcggcatctgtttagaacatataaatctatgtttcttgctcgagtgctaattggagattacataaacggagactccaaatacatgcgacctccttccaaagacgggagctatgtgaatttatatgacagctgtgtggatgatacctggaacccaaagatctttgtggtttttgatgccaaccaaatctatcctgagtacttgatagactttcattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 118, member B
- minichromosome maintenance complex component 10
- family with sequence similarity 105, member A
- chitinase 3-like 1 (cartilage glycoprotein-39)

Buy PARP11-poly (ADP-ribose) polymerase family, member 11 Gene now

Add to cart