ZDHHC16-zinc finger, DHHC-type containing 16 Gene View larger

ZDHHC16-zinc finger, DHHC-type containing 16 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC16-zinc finger, DHHC-type containing 16 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC16-zinc finger, DHHC-type containing 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004535
Product type: DNA & cDNA
Ncbi symbol: ZDHHC16
Origin species: Human
Product name: ZDHHC16-zinc finger, DHHC-type containing 16 Gene
Size: 2ug
Accessions: BC004535
Gene id: 84287
Gene description: zinc finger, DHHC-type containing 16
Synonyms: APH2; DHHC-16; Abl-philin 2; zinc finger DHHC domain-containing protein 16; zinc finger, DHHC domain containing 16; zinc finger DHHC-type containing 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaggccagcggagcctgctgctgggcccggcccgcctctgcctccgcctccttctgctgctgggttacaggcgccgctgtccacctctactccggggtctagtacagcgctggcgctacggcaaggtctgcctgcgctccctgctctacaactcctttgggggcagtgacaccgctgttgatgctgcctttgagcctgtctactggctggtagacaacgtgatccgctggtttggagtgggcaggaatgatatcgccaccgtctccatctgtaagaagtgcatttaccccaagccagcccgaacacaccactgcagcatctgcaacaggtgtgtgctgaagatggatcaccactgcccctggctaaacaattgtgtgggccactataaccatcggtacttcttctctttctgctttttcatgactctgggctgtgtctactgcagctatggaagttgggaccttttccgggaggcttatgctgccattgagacttatcaccagaccccaccacccaccttctcctttcgagaaaggatgactcacaagagtcttgtctacctctggttcctgtgcagttctgtggcacttgccctgggtgccctaactgtatggcatgctgttctcatcagtcgaggtgagactagcatcgaaaggcacatcaacaagaaggagagacgtcggctacaggccaagggcagagtatttaggaatccttacaactacggctgcttggacaactggaaggtattcctgggtgtggatacaggaaggcactggcttactcgggtgctcttaccttctagtcacttgccccatgggaatggaatgagctgggagccccctccctgggtgactgctcactcagcctctgtgatggcagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 183
- sex comb on midleg-like 4 (Drosophila)
- solute carrier family 22, member 24
- BCL2-like 14 (apoptosis facilitator)

Buy ZDHHC16-zinc finger, DHHC-type containing 16 Gene now

Add to cart