BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene View larger

BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025778
Product type: DNA & cDNA
Ncbi symbol: BCL2L14
Origin species: Human
Product name: BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene
Size: 2ug
Accessions: BC025778
Gene id: 79370
Gene description: BCL2-like 14 (apoptosis facilitator)
Synonyms: BCLG; apoptosis facilitator Bcl-2-like protein 14; BCL2-like 14 (apoptosis facilitator); apoptosis regulator BCL-G; bcl2-L-14; testicular tissue protein Li 26; BCL2 like 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtagcaccagtgggtgtgacctggaagaaatccccctagatgatgatgacctaaacaccatagaattcaaaatcctcgcctactacaccagacatcatgtcttcaagagcacccctgctctcttctcaccaaagctgctgagaacaagaagtttgtcccagaggggcctggggaattgttcagcaaatgagtcatggacagaggtgtcatggccttgcagaaattcccaatccagtgagaaggccataaaccttggcaagaaaaagtcttcttggaaagcattctttggagtagtggagaaggaagattcgcagagcacgcctgccaaggtctctgctcagggtcaaaggacgttggaataccaagattcgcacagccagcagtggtccaggtgtctttctaacgtggagcagtgcttggagcatgaagctgtggaccccaaagtcatttccattgccaaccgagtagctgaaattgtttactcctggccaccaccacaagcgacccaggcaggaggcttcaagtccaaagagatttttgtaactgagggtctctccttccagctccaaggccacgtgcctgtagcttcaagttctaagaaagatgaagaagaacaaatactagccaaaattgttgagctgctgaaatattcaggagatcagttggaaagaaagctgaagaaagataaggctttgatgggccacttccaggatgggctgtcctactctgttttcaagaccatcacagaccaggtcctaatgggtgtggaccccaggggagaatcagaggtcaaagctcagggctttaaggctgcccttgtaatagacgtcacggccaagctcacagctattgacaaccacccgatgaacagggtcctgggctttggcaccaagtacctgaaagagaacttctcgccatggatccagcagcacggtggatgggaaaaaatacttgggatatcacatgaagaagtagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 62
- solute carrier family 25, member 39
- pyruvate dehydrogenase (lipoamide) beta
- isocitrate dehydrogenase 3 (NAD+) beta

Buy BCL2L14-BCL2-like 14 (apoptosis facilitator) Gene now

Add to cart