C1orf183-chromosome 1 open reading frame 183 Gene View larger

C1orf183-chromosome 1 open reading frame 183 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf183-chromosome 1 open reading frame 183 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf183-chromosome 1 open reading frame 183 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031558
Product type: DNA & cDNA
Ncbi symbol: C1orf183
Origin species: Human
Product name: C1orf183-chromosome 1 open reading frame 183 Gene
Size: 2ug
Accessions: BC031558
Gene id: 55924
Gene description: chromosome 1 open reading frame 183
Synonyms: C1orf183; protein FAM212B; family with sequence similarity 212 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgatggagagcagggaaatggactgctatctccgtcgcctcaaacaggagctgatgtccatgaaggaggtgggtgatggcttacaggatcagatgaactgcatgatgggtgcactgcaagaactgaagctcctccaggtgcagacagcactggaacagctggagatctctggagggggtcctgtgccaggcagccctgaaggtcccaggacccagtgcgagcacccttgttgggagggtggcagaggtcctgccaggcccacagtctgttccccctccagtcaaccttctcttggcagcagcaccaagtttccatcccataggagtgtctgtggaagggatttagcccccttgcccaggacacagccacatcaaagctgtgctcagcaggggccagagcgagtggaaccggatgactggacctccacgttgatgtcccggggccggaatcgacagcctctggtgttaggggacaacgtttttgcagacctggtgggcaattggctagacttgccagaactggagaagggtggggagaagggtgagactgggggggcacgtgaacccaaaggagagaaaggccagccccaggagctgggccgcaggtttgccctgacagcaaacatctttaagaagttcttgcgtagtgtgcggcctgaccgtgaccggctgctgaaggagaagccaggctgggtgacacccatggtccctgagtcccgaaccggccgctcacagaaggtcaagaagcggagcctttccaagggctctggtcatttccccttcccaggcaccggggagcacaggcgaggggagaatccccccacaagctgccccaaggccctggagcactcaccctcaggatttgatattaacacagctgtttgggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sex comb on midleg-like 4 (Drosophila)
- solute carrier family 22, member 24
- BCL2-like 14 (apoptosis facilitator)
- chromosome 19 open reading frame 62

Buy C1orf183-chromosome 1 open reading frame 183 Gene now

Add to cart