SCML4-sex comb on midleg-like 4 (Drosophila) Gene View larger

SCML4-sex comb on midleg-like 4 (Drosophila) Gene

PTXBC033286

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCML4-sex comb on midleg-like 4 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCML4-sex comb on midleg-like 4 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033286
Product type: DNA & cDNA
Ncbi symbol: SCML4
Origin species: Human
Product name: SCML4-sex comb on midleg-like 4 (Drosophila) Gene
Size: 2ug
Accessions: BC033286
Gene id: 256380
Gene description: sex comb on midleg-like 4 (Drosophila)
Synonyms: dJ47M23.1; sex comb on midleg-like protein 4; sex comb on midleg-like 4 (Drosophila)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctgccagagaacagcttggataggttgcgacaggcagagaacccccccattccactggagagagatcaagtctcgggttctcatgactcccttagccctctcacctccgcggagtaccccagagcccgacctcagctccatccctcaggacgcagccacggtccccagcttggcggccccacaggctctcacagtctgcctctacatcaacaagcaggccaatgcggggccctatctggagaggaagaaggtgcagcagctcccggagcattttgggcccgagcggccatcggcggtgctgcagcaggccgtccaagcctgcatcgactgcgcccaccagcagaagctggtcttctccctggtcaagcagggctatggtggtgagatggtgtcagtctcggcttcctttgatggcaaacagcacctgcggagcctgcctgtggtgaacagcatcggctatgtcctccgcttcctcgccaagctgtgccgaagcctcctgtgcgatgacctcttcagccaccagcccttccccaggggctgcagtgcctctgagaaagtccaggagaaagaggaagggaggatggaatcagtcaagacagtcaccaccgaagagtacctggtgaaccctgtgggcatgaaccgctacagcgtggacacctccgcctccacctttaaccacaggggctccttgcacccctcctcctcgctgtactgcaagaggcagaactctggagacagccaccttgggggtggtcctgctgccaccgctggtggtccccgcactagccccatgtcttctggtggcccctcggcacctgggctgaggcctccagcctccagccccaagagaaacacgacctctcttgaaggaaacagatgtggtaatgtaatgcatgcatcagcttcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 22, member 24
- BCL2-like 14 (apoptosis facilitator)
- chromosome 19 open reading frame 62
- solute carrier family 25, member 39

Buy SCML4-sex comb on midleg-like 4 (Drosophila) Gene now

Add to cart