Login to display prices
Login to display prices
SLC22A24-solute carrier family 22, member 24 Gene View larger

SLC22A24-solute carrier family 22, member 24 Gene

PTXBC034394

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC22A24-solute carrier family 22, member 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC22A24-solute carrier family 22, member 24 Gene

Proteogenix catalog: PTXBC034394
Ncbi symbol: SLC22A24
Product name: SLC22A24-solute carrier family 22, member 24 Gene
Size: 2ug
Accessions: BC034394
Gene id: 283238
Gene description: solute carrier family 22, member 24
Synonyms: NET46; solute carrier family 22 member 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctttgatgtgctcctggatcaagtgggtggcatggggagattccagatttgtctgatagctttcttttgcatcaccaacatcctactgttccctaatattgtgttggagaacttcactgcattcacccctagtcatcgctgctgggtccccctcctggacaatgacagtgtgtctgacaatgataccgggaccctcagcaaggatgacctcctgagaatctccatcccactggactcaaacctgaggccacagaagtgtcagcgctttatccatccccagtggcagctccttcacctgaacgggaccttccccaacacaaatgagccagacacggagccctgtgtggatggctgggtgtacgacagaagctctttcctctccaccatcgtgactgagtgggacctggtatgtgaatctcagtcactaaaatcaatggttcaatccctatttatggctgggtcactgctgggaggtctaatatatggccatctttcagacagggttggacggaagatcatatgcaaattgtgtttcctccagctggccatctctaacacctgtgcggccttcgctcccaccttccttgtttactgcatactgcgcttcttggcagggttctccaccatgactattttgggaaacacttttattctcagcttagagtggacattgccccggtcacgatctatgacaataatggtgctattatgttcctacagtgttgggcagatgctcctaggagggctggcttttgccattcaggactggcacatattgcaactgactgtgtctacacccataattgtcctcttcttgtcctcttggtatgaacaatctccacattctttgcctgtaagcgaggctatggtagacatagaaaggaaaattgtgacacctgggatctgttcggtctctggcctagtcctgagccatgatgtccatagtacctattgtgtcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: