SLC22A24-solute carrier family 22, member 24 Gene View larger

SLC22A24-solute carrier family 22, member 24 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC22A24-solute carrier family 22, member 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC22A24-solute carrier family 22, member 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034394
Product type: DNA & cDNA
Ncbi symbol: SLC22A24
Origin species: Human
Product name: SLC22A24-solute carrier family 22, member 24 Gene
Size: 2ug
Accessions: BC034394
Gene id: 283238
Gene description: solute carrier family 22, member 24
Synonyms: NET46; solute carrier family 22 member 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctttgatgtgctcctggatcaagtgggtggcatggggagattccagatttgtctgatagctttcttttgcatcaccaacatcctactgttccctaatattgtgttggagaacttcactgcattcacccctagtcatcgctgctgggtccccctcctggacaatgacagtgtgtctgacaatgataccgggaccctcagcaaggatgacctcctgagaatctccatcccactggactcaaacctgaggccacagaagtgtcagcgctttatccatccccagtggcagctccttcacctgaacgggaccttccccaacacaaatgagccagacacggagccctgtgtggatggctgggtgtacgacagaagctctttcctctccaccatcgtgactgagtgggacctggtatgtgaatctcagtcactaaaatcaatggttcaatccctatttatggctgggtcactgctgggaggtctaatatatggccatctttcagacagggttggacggaagatcatatgcaaattgtgtttcctccagctggccatctctaacacctgtgcggccttcgctcccaccttccttgtttactgcatactgcgcttcttggcagggttctccaccatgactattttgggaaacacttttattctcagcttagagtggacattgccccggtcacgatctatgacaataatggtgctattatgttcctacagtgttgggcagatgctcctaggagggctggcttttgccattcaggactggcacatattgcaactgactgtgtctacacccataattgtcctcttcttgtcctcttggtatgaacaatctccacattctttgcctgtaagcgaggctatggtagacatagaaaggaaaattgtgacacctgggatctgttcggtctctggcctagtcctgagccatgatgtccatagtacctattgtgtcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2-like 14 (apoptosis facilitator)
- chromosome 19 open reading frame 62
- solute carrier family 25, member 39
- pyruvate dehydrogenase (lipoamide) beta

Buy SLC22A24-solute carrier family 22, member 24 Gene now

Add to cart