Login to display prices
Login to display prices
DFNA5-deafness, autosomal dominant 5 Gene View larger

DFNA5-deafness, autosomal dominant 5 Gene

PTXBC019689

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DFNA5-deafness, autosomal dominant 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DFNA5-deafness, autosomal dominant 5 Gene

Proteogenix catalog: PTXBC019689
Ncbi symbol: DFNA5
Product name: DFNA5-deafness, autosomal dominant 5 Gene
Size: 2ug
Accessions: BC019689
Gene id: 1687
Gene description: deafness, autosomal dominant 5
Synonyms: DFNA5, deafness associated tumor suppressor; ICERE-1; non-syndromic hearing impairment protein 5; deafness, autosomal dominant 5; inversely correlated with estrogen receptor expression 1; nonsyndromic hearing impairment protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaagtgtgtgatctctgagcacatgcaggtcgaggagaagtgtggtggcatcgtgggcatccagaccaagacggtgcaggtgtcagcgacggaggatgggaatgtcaccaaggactccaacgtggtgctggagatcccagctgccaccaccattgcctacggtgtcattgagttatacgtgaaactggacggccagttcgagttctgccttctccgagggaagcaaggtggcttcgagaacaagaagagaattgactctgtctacctggaccccctggtctttcgagagtttgcattcatagacatgccagatgctgcgcatgggatatcttcccaggatggaccattaagtgttttaaagcaagcgaccctgctcctggagaggaatttccatccatttgcggagctgcctgagccacaacagacagctttgagtgacatcttccaggcggtcctatttgatgatgaactactcatggtcctggaaccagtgtgcgatgacctggtcagcggcctctcgcccacagtggcggtgctgggggagctgaagccccggcagcagcaggaccttgtggccttcctgcagctggtggggtgcagcttacagggtgggtgtccgggccccgaggatgcaggcagcaagcagctgtttatgacagcctacttcttggtcagtgccctcgcagaaatgccagatagcgcagcagctctgctgggcacttgctgcaaactccagatcattcccacactgtgccacttgcttcgtgctctgtctgatgatggagtatctgatcttgaagacccaaccttgactcccctgaaagatacagaaaggtttgggattgtgcagcgcttgtttgcctcagctgacattagtctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: