PEX3-peroxisomal biogenesis factor 3 Gene View larger

PEX3-peroxisomal biogenesis factor 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX3-peroxisomal biogenesis factor 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PEX3-peroxisomal biogenesis factor 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014551
Product type: DNA & cDNA
Ncbi symbol: PEX3
Origin species: Human
Product name: PEX3-peroxisomal biogenesis factor 3 Gene
Size: 2ug
Accessions: BC014551
Gene id: 8504
Gene description: peroxisomal biogenesis factor 3
Synonyms: peroxisomal assembly protein PEX3; PBD10A; TRG18; peroxisomal biogenesis factor 3; peroxin-3; transformation-related protein 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaggtctgtatggaattttctgaaacgccacaaaaagaaatgcatcttcctgggcacggtccttggaggagtatatattctggggaaatatggacagaagaaaatcagagaaatacaggaaagggaggctgcagaatacattgcccaagcacgacgacaatatcattttgaaagtaaccagaggacttgcaatatgacagtgctgtccatgcttccaacactgagagaggccttaatgcagcaactgaattccgagagcctcacagctctgctaaaaaacaggccttcaaacaagctagaaatatgggaggatctgaagataataagtttcacaagaagtactgtggctgtatacagtacctgtatgctggttgttcttttgcgggtccagttaaacataattggtggatatatttacctggataatgcagcagttggcaaaaatggcactacaattcttgctcccccagatgtccaacagcagtatttatcaagtattcagcacctacttggagatggcctgacagaattgatcactgtcattaaacaagctgtgcagaaggttttaggaagtgtttctcttaaacattctttgtcccttttggacttggagcaaaaactaaaagaaatcagaaatctcgttgagcagcataagtcttcttcttggattaataaagatggatccaaacctttattatgccattatatgatgccagatgaagaaactccattagcagtgcaggcctgtggactttctcctcgagacattaccactattaaacttctcaatgaaactagagacatgttggaaagcccagattttagtacagttttgaatacctgtttaaaccgaggttttagtagacttctagacaatatggctgagttctttcgacctactgaacaggacctgcaacatggtaactctatgaatagtctttccagtgtcagcctgcctttagctaagataattccaatagtaaacggacagatccattcagtttgcagtgaaacacctagtcattttgttcaggatctgttgacaatggagcaagtgaaagactttgctgctaatgtgtatgaagcttttagtacccctcagcaactggagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin, alpha, cardiac muscle 1
- RNA binding motif protein 15B
- glial fibrillary acidic protein
- PDZ and LIM domain 7 (enigma)

Buy PEX3-peroxisomal biogenesis factor 3 Gene now

Add to cart