ACTC1-actin, alpha, cardiac muscle 1 Gene View larger

ACTC1-actin, alpha, cardiac muscle 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTC1-actin, alpha, cardiac muscle 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACTC1-actin, alpha, cardiac muscle 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009978
Product type: DNA & cDNA
Ncbi symbol: ACTC1
Origin species: Human
Product name: ACTC1-actin, alpha, cardiac muscle 1 Gene
Size: 2ug
Accessions: BC009978
Gene id: 70
Gene description: actin, alpha, cardiac muscle 1
Synonyms: ACTC; ASD5; CMD1R; CMH11; LVNC4; actin, alpha cardiac muscle 1; actin, alpha, cardiac muscle 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgacgacgaggagaccaccgccctggtgtgcgacaacggctctgggctggtgaaggccggctttgcgggcgatgacgcgccccgcgctgtcttcccgtccatcgtgggccgcccgcggcaccagggagttatggtgggtatgggtcagaaggactcctacgtaggtgatgaagcccagagcaagagaggcatcctgaccctgaagtatcccatcgagcatggtatcatcaccaactgggacgacatggagaagatctggcaccacaccttctacaatgagctccgtgtggctcccgaggagcaccccaccctgctcacagaggccccgctgaaccccaaggccaaccgggagaagatgactcagatcatgtttgagaccttcaatgtccctgccatgtacgtggccatccaggcagtgctatccctgtatgcttctggccgtaccacaggcattgttctggactctggggatggtgtaactcacaatgtccccatctatgagggctacgctttgccccatgccatcatgcgtctggatctggctggtcgggacctcactgactacctcatgaagatcctcactgagcgtggctactcctttgtcaccactgctgaacgtgaaattgtccgtgacattaaagagaagctgtgctatgtcgccctggattttgagaatgagatggccacagctgcctcttcctcctccctggagaagagctatgaactgcctgatggccaagtcatcactattggcaatgagcgcttccgctgtcctgagacactcttccagccctccttcattggtatggaatctgctggcatccatgaaacaacttacaatagcatcatgaagtgtgacattgatatccgcaaggacctgtatgccaacaatgtcttatctggaggcaccactatgtaccctggtattgctgatcgtatgcagaaggaaatcactgctctggctcctagcaccatgaagattaagattattgctccccctgagcgtaaatactctgtctggattgggggctccatcctggcctctctgtccaccttccagcaaatgtggattagcaagcaagagtacgatgaggcaggcccatccattgtccaccgcaaatgcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 15B
- glial fibrillary acidic protein
- PDZ and LIM domain 7 (enigma)
- phosphatidylserine synthase 1

Buy ACTC1-actin, alpha, cardiac muscle 1 Gene now

Add to cart