Login to display prices
Login to display prices
ACTC1-actin, alpha, cardiac muscle 1 Gene View larger

ACTC1-actin, alpha, cardiac muscle 1 Gene

PTXBC009978

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTC1-actin, alpha, cardiac muscle 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTC1-actin, alpha, cardiac muscle 1 Gene

Proteogenix catalog: PTXBC009978
Ncbi symbol: ACTC1
Product name: ACTC1-actin, alpha, cardiac muscle 1 Gene
Size: 2ug
Accessions: BC009978
Gene id: 70
Gene description: actin, alpha, cardiac muscle 1
Synonyms: ACTC; ASD5; CMD1R; CMH11; LVNC4; actin, alpha cardiac muscle 1; actin, alpha, cardiac muscle 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgacgacgaggagaccaccgccctggtgtgcgacaacggctctgggctggtgaaggccggctttgcgggcgatgacgcgccccgcgctgtcttcccgtccatcgtgggccgcccgcggcaccagggagttatggtgggtatgggtcagaaggactcctacgtaggtgatgaagcccagagcaagagaggcatcctgaccctgaagtatcccatcgagcatggtatcatcaccaactgggacgacatggagaagatctggcaccacaccttctacaatgagctccgtgtggctcccgaggagcaccccaccctgctcacagaggccccgctgaaccccaaggccaaccgggagaagatgactcagatcatgtttgagaccttcaatgtccctgccatgtacgtggccatccaggcagtgctatccctgtatgcttctggccgtaccacaggcattgttctggactctggggatggtgtaactcacaatgtccccatctatgagggctacgctttgccccatgccatcatgcgtctggatctggctggtcgggacctcactgactacctcatgaagatcctcactgagcgtggctactcctttgtcaccactgctgaacgtgaaattgtccgtgacattaaagagaagctgtgctatgtcgccctggattttgagaatgagatggccacagctgcctcttcctcctccctggagaagagctatgaactgcctgatggccaagtcatcactattggcaatgagcgcttccgctgtcctgagacactcttccagccctccttcattggtatggaatctgctggcatccatgaaacaacttacaatagcatcatgaagtgtgacattgatatccgcaaggacctgtatgccaacaatgtcttatctggaggcaccactatgtaccctggtattgctgatcgtatgcagaaggaaatcactgctctggctcctagcaccatgaagattaagattattgctccccctgagcgtaaatactctgtctggattgggggctccatcctggcctctctgtccaccttccagcaaatgtggattagcaagcaagagtacgatgaggcaggcccatccattgtccaccgcaaatgcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: