H2AFY2-H2A histone family, member Y2 Gene View larger

H2AFY2-H2A histone family, member Y2 Gene

PTXBC016172

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H2AFY2-H2A histone family, member Y2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about H2AFY2-H2A histone family, member Y2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016172
Product type: DNA & cDNA
Ncbi symbol: H2AFY2
Origin species: Human
Product name: H2AFY2-H2A histone family, member Y2 Gene
Size: 2ug
Accessions: BC016172
Gene id: 55506
Gene description: H2A histone family, member Y2
Synonyms: macroH2A2; core histone macro-H2A.2; core histone macroH2A2.2; histone macroH2A2; mH2A2; H2A histone family member Y2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggccggagtgggaagaagaaaatgtccaagctgtcccgttcagctagggcaggtgtcatctttccagtggggaggctgatgcgttatctgaagaaagggacgttcaagtaccggatcagcgtgggcgcccctgtctacatggcggcagtcattgagtacctggcagcggaaattctagaattggccggcaatgccgcgagggacaacaagaaggcccggatagccccgagacacatcttgctggcagttgccaatgacgaggagctcaaccagctgctaaaaggagtgaccatcgccagtggaggcgtcctgcccagaattcaccccgaactgctggccaaaaagcgagggaccaaaggcaagtcggaaacgatcctctccccacccccagagaaaagaggcaggaaggccacgtcaggcaagaagggggggaagaaatccaaggctgccaaaccacggacgtccaaaaagtccaaaccaaaggacagcgataaagaaggaacttcaaattccacctctgaagatgggccaggggatggattcaccattctgtcttctaagagccttgttctgggacagaagctgtccttaacccagagtgacatcagccatattggctccatgagagtggagggcattgtccacccaaccacagccgaaattgacctcaaagaagatataggtaaagccttggaaaaggctgggggaaaagagttcttggaaacggtaaaggagcttcgcaaatcccaaggccctttggaagtcgccgaagccgccgtcagccaatccagtggactcgcagccaaatttgtcatccactgtcacatccctcagtggggctccgacaaatgtgaagaacagcttgaagagaccatcaaaaactgcctgtcagcggcggaggacaagaagctaaagtccgtcgcgttcccgcctttccccagcggcagaaactgctttcccaaacagactgcggcccaggtgaccctcaaagccatctcagcccactttgatgactcgagcgcgtcctcgctgaagaacgtgtacttcctgctcttcgacagcgagagcatcggcatctacgtgcaggagatggccaagctcgacgccaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisomal biogenesis factor 3
- actin, alpha, cardiac muscle 1
- RNA binding motif protein 15B
- glial fibrillary acidic protein

Buy H2AFY2-H2A histone family, member Y2 Gene now

Add to cart