NEUROD1-neurogenic differentiation 1 Gene View larger

NEUROD1-neurogenic differentiation 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEUROD1-neurogenic differentiation 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NEUROD1-neurogenic differentiation 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009046
Product type: DNA & cDNA
Ncbi symbol: NEUROD1
Origin species: Human
Product name: NEUROD1-neurogenic differentiation 1 Gene
Size: 2ug
Accessions: BC009046
Gene id: 4760
Gene description: neurogenic differentiation 1
Synonyms: BETA2; BHF-1; MODY6; NEUROD; bHLHa3; neurogenic differentiation factor 1; basic helix-loop-helix transcription factor; beta-cell E-box transactivator 2; class A basic helix-loop-helix protein 3; neurogenic helix-loop-helix protein NEUROD; neuronal differentiation 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaaatcgtacagcgagagtgggctgatgggcgagcctcagccccaaggtcctccaagctggacagacgagtgtctcagttctcaggacgaggagcacgaggcagacaagaaggaggacgacctcgaagccatgaacgcagaggaggactcactgaggaacgggggagaggaggaggacgaagatgaggacctggaagaggaggaagaagaggaagaggaggatgacgatcaaaagcccaagagacgcggccccaaaaagaagaagatgactaaggctcgcctggagcgttttaaattgagacgcatgaaggctaacgcccgggagcggaaccgcatgcacggactgaacgcggcgctagacaacctgcgcaaggtggtgccttgctattctaagacgcagaagctgtccaaaatcgagactctgcgcttggccaagaactacatctgggctctgtcggagatcctgcgctcaggcaaaagcccagacctggtctccttcgttcagacgctttgcaagggcttatcccaacccaccaccaacctggttgcgggctgcctgcaactcaatcctcggacttttctgcctgagcagaaccaggacatgcccccccacctgccgacggccagcgcttccttccctgtacacccctactcctaccagtcgcctgggctgcccagtccgccttacggtaccatggacagctcccatgtcttccacgttaagcctccgccgcacgcctacagcgcagcgctggagcccttctttgaaagccctctgactgattgcaccagcccttcctttgatggacccctcagcccgccgctcagcatcaatggcaacttctctttcaaacacgaaccgtccgccgagtttgagaaaaattatgcctttaccatgcactatcctgcagcgacactggcaggggcccaaagccacggatcaatcttctcaggcaccgctgcccctcgctgcgagatccccatagacaatattatgtccttcgatagccattcacatcatgagcgagtcatgagtgcccagctcaatgccatatttcatgattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - H2A histone family, member Y2
- peroxisomal biogenesis factor 3
- actin, alpha, cardiac muscle 1
- RNA binding motif protein 15B

Buy NEUROD1-neurogenic differentiation 1 Gene now

Add to cart