NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene View larger

NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene

PTXBC002398

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002398
Product type: DNA & cDNA
Ncbi symbol: NPM1
Origin species: Human
Product name: NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene
Size: 2ug
Accessions: BC002398
Gene id: 4869
Gene description: nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Synonyms: B23; NPM; nucleophosmin; nucleolar protein NO38; nucleophosmin (nucleolar phosphoprotein B23, numatrin); nucleophosmin/nucleoplasmin family, member 1; testicular tissue protein Li 128
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagattcgatggacatggacatgagccccctgaggccccagaactatcttttcggttgtgaactaaaggccgacaaagattatcactttaaggtggataatgatgaaaatgagcaccagttatctttaagaacggtcagtttaggggctggtgcaaaggatgagttgcacattgttgaagcagaggcaatgaattacgaaggcagtccaattaaagtaacactggcaactttgaaaatgtctgtacagccaacggtttcccttgggggctttgaaataacaccaccagtggtcttaaggttgaagtgtggttcagggccagtgcatattagtggacagcacttagtagctgtggaggaagatgcagagtcagaagatgaagaggaggaggatgtgaaactcttaagtatatctggaaagcggtctgcccctggaggtggtagcaaggttccacagaaaaaagtaaaacttgctgctgatgaagatgatgacgatgatgatgaagaggatgatgatgaagatgatgatgatgatgattttgatgatgaggaagctgaagaaaaagcgccagtgaagaaatctatacgagatactccagccaaaaatgcacaaaagtcaaatcagaatggaaaagactcaaaaccatcatcaacaccaagatcaaaaggacaagaatccttcaagaaacaggaaaaaactcctaaaacaccaaaaggacctagttctgtagaagacattaaagcaaaaatgcaagcaagtatagaaaaaggtggttctcttcccaaagtggaagccaaattcatcaattatgtgaagaattgcttccggatgactgaccaagaggctattcaagatctctggcagtggaggaagtctctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 3, subunit G
- membrane bound O-acyltransferase domain containing 7
- eukaryotic translation initiation factor 3, subunit F
- wingless-type MMTV integration site family, member 5B

Buy NPM1-nucleophosmin (nucleolar phosphoprotein B23, numatrin) Gene now

Add to cart