Login to display prices
Login to display prices
C13orf26-chromosome 13 open reading frame 26 Gene View larger

C13orf26-chromosome 13 open reading frame 26 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C13orf26-chromosome 13 open reading frame 26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C13orf26-chromosome 13 open reading frame 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030277
Product type: DNA & cDNA
Ncbi symbol: C13orf26
Origin species: Human
Product name: C13orf26-chromosome 13 open reading frame 26 Gene
Size: 2ug
Accessions: BC030277
Gene id: 122046
Gene description: chromosome 13 open reading frame 26
Synonyms: C13orf26; testis-expressed sequence 26 protein; testis expressed 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacagcctgggcccagggctccggatccctctctctgccaccacaacctccagccaacagatgaccccaactgggattcctatgctaccactatgaggactgcattcacgcctaaaacaggagcagtgcctgccttaattcgccaaaacggtatcagaagattaggatatacatattcacttagtgatcctattctcaatcagacacaatatagtgatgagtacacttggaaatcacactctaaagaagatttgatcaaaactgagacttcaagaggaatcaagagccacaaatctcatctcaatgaagacattttcctgtggacactacctcactgtcaacaaacggggacactaaagaactgcctcccttggaaaatcccggcttcaatgaaagaagttaacaaggcactatcaaatcagtttatttcccttactaagagagactttgtggacagatcaaaagctcagaagattaagaaaagttctcacttgtctctggaatggaaaaagttacttccccaacctccagacactgaattccgaaggaattaccaaattccagctaaaattcctgagcttcaagatttcagtttcaaatatggatgctactcaagcttgcctgttgcttctcagggtctagtgccttctgtgctgcacagctacctgaggaaccaagagcacacaaagaaacagaccacataccaaagtgactacgacaaaacctacccagatttcttaatgcttttaaactcatttacttcctctcaagtcaaagagtaccttcagagtctttcctacaaagatagacaaattattgatcgctttattcgtactcactgtgacactaacaaaaagaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 16
- chromosome 1 open reading frame 183
- sex comb on midleg-like 4 (Drosophila)
- solute carrier family 22, member 24