Login to display prices
Login to display prices
AGBL2-ATP/GTP binding protein-like 2 Gene View larger

AGBL2-ATP/GTP binding protein-like 2 Gene

PTXBC028200

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AGBL2-ATP/GTP binding protein-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AGBL2-ATP/GTP binding protein-like 2 Gene

Proteogenix catalog: PTXBC028200
Ncbi symbol: AGBL2
Product name: AGBL2-ATP/GTP binding protein-like 2 Gene
Size: 2ug
Accessions: BC028200
Gene id: 79841
Gene description: ATP/GTP binding protein-like 2
Synonyms: CCP2; cytosolic carboxypeptidase 2; cytoplasmic carboxypeptidase 2; testis tissue sperm-binding protein Li 96mP; ATP/GTP binding protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcggatgggaatcctaaacagctacaccatggagtctacctttggcgggtccaccctgggtaataaaagagacacccactttaccatcgaagatctgaagtccttaggttatcatgtctgtgacacccttctggacttttgtgatcctgaccaaattaagttcactcagtgtctagcagagcttaaggagcttctacgacaggaaatccacaagaaattccatgaacttggacaagatgtagatttagaaggaagttggagtgacatctctttgtctgacattgaatccagcaccagtggctctgacagttctctctcagatggtcttcctgttcacctagcaaacatagcagatgagctgactcagaaaaagaagatgtttaagaagaaaaaaaagaagtcacttcagactaggaaacagcgaaatgagcagtatcagaaaaaaaatttgatgcagaagttaaagttaacagaagatacctcagaaaaggcaggatttgcttctactctgcaaaagcagccaacctttttcaaaaactcagagaattccagttttttaccaatgaaaaatgaaaacccaaggttaaatgagacaaatttaaatagaagagacaaagacacccccctggacccatcaatggccaccctgattctgcctaagaataaagggagaatgcagaataagaagccaggctttacagtatcatgctctccaaagagaaccataaactccagccaagagccagctccaggtatgaagccaaactggcctaggagcagatatcctgccacaaagagaggctgtgctgccatggcggcatacccatccttgcacatatacacatacccgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: