SMN2-survival of motor neuron 2, centromeric Gene View larger

SMN2-survival of motor neuron 2, centromeric Gene

PTXBC000908

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMN2-survival of motor neuron 2, centromeric Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMN2-survival of motor neuron 2, centromeric Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000908
Product type: DNA & cDNA
Ncbi symbol: SMN2
Origin species: Human
Product name: SMN2-survival of motor neuron 2, centromeric Gene
Size: 2ug
Accessions: BC000908
Gene id: 6607
Gene description: survival of motor neuron 2, centromeric
Synonyms: BCD541; C-BCD541; GEMIN1; SMNC; TDRD16B; survival motor neuron protein; component of gems 1; gemin-1; tudor domain containing 16B; survival of motor neuron 2, centromeric
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgatgagcagcggcggcagtggtggcggcgtcccggagcaggaggattccgtgctgttccggcgcggcacaggccagagcgatgattctgacatttgggatgatacagcactgataaaagcatatgataaagctgtggcttcatttaagcatgctctaaagaatggtgacatttgtgaaacttcgggtaaaccaaaaaccacacctaaaagaaaacctgctaagaagaataaaagccaaaagaagaatactgcagcttccttacaacagtggaaagttggggacaaatgttctgccatttggtcagaagacggttgcatttacccagctaccattgcttcaattgattttaagagagaaacctgtgttgtggtttacactggatatggaaatagagaggagcaaaatctgtccgatctactttccccaatctgtgaagtagctaataatatagaacagaatgctcaagagaatgaaaatgaaagccaagtttcaacagatgaaagtgagaactccaggtctcctggaaataaatcagataacatcaagcccaaatctgctccatggaactcttttctccctccaccaccccccatgccagggccaagactgggaccaggaaagccaggtctaaaattcaatggcccaccaccgccaccgccaccaccaccaccccacttactatcatgctggctgcctccatttccttctggaccaccaataattcccccaccacctcccatatgtccagattctcttgatgatgctgatgctttgggaagtatgttaatttcatggtacatgagtggctatcatactggctattatatggaaatgctggcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 13 open reading frame 26
- zinc finger, DHHC-type containing 16
- chromosome 1 open reading frame 183
- sex comb on midleg-like 4 (Drosophila)

Buy SMN2-survival of motor neuron 2, centromeric Gene now

Add to cart