WDFY3-WD repeat and FYVE domain containing 3 Gene View larger

WDFY3-WD repeat and FYVE domain containing 3 Gene

PTXBC013377

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDFY3-WD repeat and FYVE domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDFY3-WD repeat and FYVE domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013377
Product type: DNA & cDNA
Ncbi symbol: WDFY3
Origin species: Human
Product name: WDFY3-WD repeat and FYVE domain containing 3 Gene
Size: 2ug
Accessions: BC013377
Gene id: 23001
Gene description: WD repeat and FYVE domain containing 3
Synonyms: ALFY; ZFYVE25; WD repeat and FYVE domain-containing protein 3; autophagy-linked FYVE protein; WD repeat and FYVE domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatttttgcaagttcctgaaacaccagctcctgagcctgctgaagtcctagaaatgcaggaagactgtccagaagcacaaatagggcaggaagcccaagacgaggacagcagtgattcagaagcagatgagcagagcatcagccaggaccctaaggacactccaagccaacccagcagcaccagccacaggccccgggcagcctcctgccgcgcaacagccgcctggtgtactgacagtggctctgacgactccagacgctggtccgaccagctcagtctagatgagaaagacggcttcatatttgtgaactattcagagggccagaccagagcccatctgcagggcccccttagccacccccaccccaatcccattgaggtgcggaattacagcagattgaaacctgggtaccgatgggaacggcagctggtgttcaggagtaagctgactatgcacacagcctttgatcgaaaggacaatgcacacccagctgaggtcactgccttgggcatctccaaggatcacagtaggatcctcgttggtgacagtcgaggccgagttttcagctggtctgtgagtgaccagccaggccgttctgctgctgatcactgggtgaaggatgaaggtggtgacagctgctcaggctgctcggtgaggttttcactcacagaaagacgacaccattgcaggaactgcggtcagctcttctgccagaagtgcagtcgctttcaatctgaaatcaaacgcttgaaaatctcatccccggtgcgtgtttgtcagaactgttattataacttacagcatgagagaggttcagaagatgggcctcgaaattgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - survival of motor neuron 2, centromeric
- chromosome 13 open reading frame 26
- zinc finger, DHHC-type containing 16
- chromosome 1 open reading frame 183

Buy WDFY3-WD repeat and FYVE domain containing 3 Gene now

Add to cart