SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene View larger

SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene

PTXBC036031

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036031
Product type: DNA & cDNA
Ncbi symbol: SNAPC3
Origin species: Human
Product name: SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene
Size: 2ug
Accessions: BC036031
Gene id: 6619
Gene description: small nuclear RNA activating complex, polypeptide 3, 50kDa
Synonyms: PTFbeta; SNAP50; snRNA-activating protein complex subunit 3; PSE-binding factor subunit beta; PTF subunit beta; SNAPc 50 kDa subunit; SNAPc subunit 3; proximal sequence element-binding transcription factor subunit beta; small nuclear RNA activating complex, polypeptide 3, 50kD; small nuclear RNA activating complex, polypeptide 3, 50kDa; snRNA-activating protein complex 50 kDa subunit; small nuclear RNA activating complex polypeptide 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaaggaagccgaggtggccctacgtgtagcggggtgggtggcaggcaggacccagtctccggcagtggcggctgcaactttccagagtatgagcttcccgagctaaatacgcgcgctttccatgtgggcgcctttggggagctgtggcggggccgtctgcgcggggccggggacttgtcgctgagggagccgccggcatccgctctgcctgggagccaggcagctgactccgaccgggaggatgccgcggtggccagggatctggactgcagcctggaggcggcggctgagctgagggcggtgtgcggccttgataaactgaaatgccttgaggacggtgaggatccagaagtcattccggagaatactgacctggtgactttgggggttagaaaaaggttcttggaacatcgggaagaaaccattacaatagatcgagcctgcagacaagaaacattcgtttatgagatggagtcacatgccataggaaaaaagcctgaaaattcagcagacatgattgaagaaggggagcttatcctatctgtgaatatcttgtaccctgttatatttcataagcacaaagaacacaaaccataccaaacaatgctggtgttgggcagtcaaaaactcacacaactgagggattcaattcgatgtgtcagtgacctccagattggtggtgaattcagcaacactcctgaccaagcccctgagcacatcagcaaagacctatacaaatcagccttctttttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EGF-containing fibulin-like extracellular matrix protein 2
- Smith-Magenis syndrome chromosome region, candidate 7-like
- interferon-induced protein with tetratricopeptide repeats 5
- interferon-induced protein with tetratricopeptide repeats 3

Buy SNAPC3-small nuclear RNA activating complex, polypeptide 3, 50kDa Gene now

Add to cart