SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene View larger

SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010862
Product type: DNA & cDNA
Ncbi symbol: SYF2
Origin species: Human
Product name: SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene
Size: 2ug
Accessions: BC010862
Gene id: 25949
Gene description: SYF2 homolog, RNA splicing factor (S. cerevisiae)
Synonyms: SYF2 pre-mRNA splicing factor; SYF2 homolog, RNA splicing factor; pre-mRNA-splicing factor SYF2; CBPIN; NTC31; P29; fSAP29; CCNDBP1 interactor; GCIP-interacting protein p29; functional spliceosome-associated protein 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctatagctgcatccgaggtgctggtggacagcgcggaggaggggtccctcgctgcggcggcggagctggccgctcagaagcgcgaacagagactgcgcaaattccgggagctgcacctgatgcggaatgaagctcgtaaattaaatcaccaggaagttgtggaagaagataaaagactaaaattacctgcaaattgggaagccaaaaaagctcgtttggagtgggaactaaaggaagaggaaaagaaaaaggaatgtgcggcaagaggagaagactatgagaaagtgaagttgctggagatcagtgcagaagatgcagaaagatgggagaggaaaaagaagaggaaaaaccctgatctgggattttcagattatgctgctgcccagttacgccagtatcatcggttgaccaagcagatcaaacctgacatggaaacatatgagagactgagagaaaaacatggagaagagtttttcccaacatccaatagtcttcttcatggaacacatgtgccttccacagaggaaattgacaggatggtcatagatctggaaaaacagattgaaaaacgagacaaatatagccggagacgtccttataatgatgatgcagatatcgactacattaatgaaaggaatgccaaattcaacaagaaagctgaaagattctatgggaaatacacagctgaaattaaacagaatttggaaagaggaacagctgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ral GEF with PH domain and SH3 binding motif 1
- fibronectin type III and SPRY domain containing 1
- CDC42 effector protein (Rho GTPase binding) 4
- branched chain aminotransferase 2, mitochondrial

Buy SYF2-SYF2 homolog, RNA splicing factor (S. cerevisiae) Gene now

Add to cart