C1orf2-chromosome 1 open reading frame 2 Gene View larger

C1orf2-chromosome 1 open reading frame 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf2-chromosome 1 open reading frame 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf2-chromosome 1 open reading frame 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008854
Product type: DNA & cDNA
Ncbi symbol: C1orf2
Origin species: Human
Product name: C1orf2-chromosome 1 open reading frame 2 Gene
Size: 2ug
Accessions: BC008854
Gene id: 10712
Gene description: chromosome 1 open reading frame 2
Synonyms: C1orf2; COTE1; protein FAM189B; family with sequence similarity 189 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgccctcgcctagtgactccagccgctcgctgaccagccggcccagcaccaggggccttacccacctccgcctccaccgaccctggctgcaggccctgcttacgctggggctggtccaagtgctcctgggcatcctggtggtcaccttcagcatggtggcctcttccgtcaccaccaccgagagcatcaagaggtcctgcccgtcttgggctgggttctcgaacctgctcttcagcgtctgtgggctcaccatttgtgccgctataatctgtacactctctgctattgtctgctgcatccaaatcttctccctggacctcgtgcatacgctggcccctgagcggtcagtctcaggcccactgggacctctgggctgcacgtccccgcccccagcccctctcctacacaccatgctggacctggaggaatttgtcccgcctgtgcccccaccgccctactatcccccagagtatacctgcagctcagaaacagatgcacagagcatcacgtacaatggctccatggacagcccagtgcccttgtaccctaccgattgccccccttcttatgaggcagtcatgggactacgaggaggaaaacaaattcttgtccccctcagaatgagagtggctctttctgatttgcaagggcactatggtcagggcaaaggcatggcccaggtgtttaagtacagggtgacgtgtgcctatgcaatggggtggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine-rich secretory protein 2
- leucine rich repeat containing 61
- gap junction protein, beta 3, 31kDa
- tetratricopeptide repeat domain 35

Buy C1orf2-chromosome 1 open reading frame 2 Gene now

Add to cart