Login to display prices
Login to display prices
LRRC61-leucine rich repeat containing 61 Gene View larger

LRRC61-leucine rich repeat containing 61 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC61-leucine rich repeat containing 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC61-leucine rich repeat containing 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001354
Product type: DNA & cDNA
Ncbi symbol: LRRC61
Origin species: Human
Product name: LRRC61-leucine rich repeat containing 61 Gene
Size: 2ug
Accessions: BC001354
Gene id: 65999
Gene description: leucine rich repeat containing 61
Synonyms: HSPC295; leucine-rich repeat-containing protein 61; leucine rich repeat containing 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccctccagcggagaagccgggagaggctggcggactgcagatcacaccccagctgctgaagtcacgcacaggcgagttctccctggagtccatcctgctactgaagctgcgtggcttgggactggctgacctgggctgcctgggagagtgcctgggcctggagtggctggacctatcaggcaacgcgctcacccacctgggcccgctggcctccttgcgccagctagctgtgctcaatgtctccaacaatcggctgacgggcctggagccactggccacctgtgagaacttgcagagtctcaatgccgcaggcaacctactggccaccccgggccagctgcagtgtctggctgggctaccgtgcctggagtacctgcggctccgagaccctttggcccggctcagcaacccgctctgtgccaacccctcctactgggctgcagtccgggagctgctgcctggcctgaaagtcatcgacggtgagcgtgtgattgggcgtggtagtgagttctaccagctgtgccgagacctggacagctccttgcgtcccagctccagtccaggccccagagccaccgaggcccagccctgggtggagccaggctactgggagtcctggcccagccggagcagctccatcctggaggaggcctgccggcagttccaggacacactgcaggagtgctgggacctggaccgccaggccagcgacagcctggcccaggcggagcaggtactcagctctgcgggccccacctcttccttcgtcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gap junction protein, beta 3, 31kDa
- tetratricopeptide repeat domain 35
- zinc finger CCCH-type containing 8
- mitochondrial ribosomal protein L1