Login to display prices
Login to display prices
TTC35-tetratricopeptide repeat domain 35 Gene View larger

TTC35-tetratricopeptide repeat domain 35 Gene

PTXBC021667

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC35-tetratricopeptide repeat domain 35 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC35-tetratricopeptide repeat domain 35 Gene

Proteogenix catalog: PTXBC021667
Ncbi symbol: TTC35
Product name: TTC35-tetratricopeptide repeat domain 35 Gene
Size: 2ug
Accessions: BC021667
Gene id: 9694
Gene description: tetratricopeptide repeat domain 35
Synonyms: TTC35; KIAA0103; ER membrane protein complex subunit 2; TPR repeat protein 35; tetratricopeptide repeat domain 35; tetratricopeptide repeat protein 35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaaggtctcagagctttacgatgtcacttgggaagaaatgagagataaaatgagaaaatggagagaagaaaactcaagaaatagtgagcaaattgtggaagttggagaagaattaattaatgaatatgcttctaagctgggagatgatatttggatcatatatgaacaggtgatgattgcagcactagactatggtcgggatgacttggcattgttttgtcttcaagagctgagaagacagttccctggcagtcacagagtcaagcgattaacaggcatgagatttgaagccatggaaagatatgatgatgctatacagctatatgataggattttacaagaagatccaactaacactgctgcaagaaagcgtaagattgccattcgaaaagcccaggggaaaaatgtggaggccattcgggagctgaatgagtatctggaacaatttgttggagaccaagaagcctggcatgaacttgcagaactttacatcaatgaacatgactatgcaaaagcagccttttgtttagaggaactaatgatgactaatccacacaaccacttatactgtcagcagtatgctgaagttaagtatacccaaggtggacttgaaaacctcgaactttcaagaaagtattttgcacaggcattgaaactgaacaacagaaatatgagagctttgtttggactttatatgtcggcaagtcatattgcttctaatccaaaagcaagtgcaaaaacgaaaaaggacaacatgaaatatgctagttgggcagctagtcaaataaacagagcttatcagtttgcaggtcgaagtaagaaggaaaccaaatattctcttaaggctgtcgaagacatgttggaaacattgcagatcacccagtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: