Login to display prices
Login to display prices
GJB3-gap junction protein, beta 3, 31kDa Gene View larger

GJB3-gap junction protein, beta 3, 31kDa Gene

PTXBC012918

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB3-gap junction protein, beta 3, 31kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GJB3-gap junction protein, beta 3, 31kDa Gene

Proteogenix catalog: PTXBC012918
Ncbi symbol: GJB3
Product name: GJB3-gap junction protein, beta 3, 31kDa Gene
Size: 2ug
Accessions: BC012918
Gene id: 2707
Gene description: gap junction protein, beta 3, 31kDa
Synonyms: CX31; DFNA2; DFNA2B; EKV; gap junction beta-3 protein; connexin 31; gap junction protein, beta 3, 31kDa; gap junction protein beta 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggaagacactccaggccctactgagcggtgtgaacaagtactccacagcgttcgggcgcatctggctgtccgtggtgttcgtcttccgggtgctggtatacgtggtggctgcagagcgcgtgtggggggatgagcagaaggactttgactgcaacaccaagcagcccggctgcaccaacgtctgctacgacaactacttccccatctccaacatccgcctctgggccctgcagctcatcttcgtcacatgcccctcgctgctggtcatcctgcacgtggcctaccgtgaggagcgggagcgccggcaccgccagaaacacggggaccagtgcgccaagctgtacgacaacgcaggcaagaagcacggaggcctgtggtggacctacctgttcagcctcatcttcaagctcatcattgagttcctcttcctctacctgctgcacactctctggcatggcttcaatatgccgcgcctggtgcagtgtgccaacgtggccccctgccccaacatcgtggactgctacattgcccgacctaccgagaagaaaatcttcacctacttcatggtgggcgcctccgccgtctgcatcgtactcaccatctgtgagctctgctacctcatctgccacagggtcctgcgaggcctgcacaaggacaagcctcgagggggttgcagcccctcgtcctccgccagccgagcttccacctgccgctgccaccacaagctggtggaggctggggaggtggatccagacccaggcaataacaagctgcaggcttcagcacccaacctgacccccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: