GJB3-gap junction protein, beta 3, 31kDa Gene View larger

GJB3-gap junction protein, beta 3, 31kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB3-gap junction protein, beta 3, 31kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GJB3-gap junction protein, beta 3, 31kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012918
Product type: DNA & cDNA
Ncbi symbol: GJB3
Origin species: Human
Product name: GJB3-gap junction protein, beta 3, 31kDa Gene
Size: 2ug
Accessions: BC012918
Gene id: 2707
Gene description: gap junction protein, beta 3, 31kDa
Synonyms: CX31; DFNA2; DFNA2B; EKV; gap junction beta-3 protein; connexin 31; gap junction protein, beta 3, 31kDa; gap junction protein beta 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactggaagacactccaggccctactgagcggtgtgaacaagtactccacagcgttcgggcgcatctggctgtccgtggtgttcgtcttccgggtgctggtatacgtggtggctgcagagcgcgtgtggggggatgagcagaaggactttgactgcaacaccaagcagcccggctgcaccaacgtctgctacgacaactacttccccatctccaacatccgcctctgggccctgcagctcatcttcgtcacatgcccctcgctgctggtcatcctgcacgtggcctaccgtgaggagcgggagcgccggcaccgccagaaacacggggaccagtgcgccaagctgtacgacaacgcaggcaagaagcacggaggcctgtggtggacctacctgttcagcctcatcttcaagctcatcattgagttcctcttcctctacctgctgcacactctctggcatggcttcaatatgccgcgcctggtgcagtgtgccaacgtggccccctgccccaacatcgtggactgctacattgcccgacctaccgagaagaaaatcttcacctacttcatggtgggcgcctccgccgtctgcatcgtactcaccatctgtgagctctgctacctcatctgccacagggtcctgcgaggcctgcacaaggacaagcctcgagggggttgcagcccctcgtcctccgccagccgagcttccacctgccgctgccaccacaagctggtggaggctggggaggtggatccagacccaggcaataacaagctgcaggcttcagcacccaacctgacccccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 35
- zinc finger CCCH-type containing 8
- mitochondrial ribosomal protein L1
- mitochondrial ribosomal protein L4

Buy GJB3-gap junction protein, beta 3, 31kDa Gene now

Add to cart