CRISP2-cysteine-rich secretory protein 2 Gene View larger

CRISP2-cysteine-rich secretory protein 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRISP2-cysteine-rich secretory protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRISP2-cysteine-rich secretory protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022011
Product type: DNA & cDNA
Ncbi symbol: CRISP2
Origin species: Human
Product name: CRISP2-cysteine-rich secretory protein 2 Gene
Size: 2ug
Accessions: BC022011
Gene id: 7180
Gene description: cysteine-rich secretory protein 2
Synonyms: CRISP-2; CT36; GAPDL5; TPX1; TSP1; cysteine-rich secretory protein 2; cancer/testis antigen 36; glyceraldehyde-3-phosphate dehydrogenase-like 5; testicular tissue protein Li 43; testis specific protein 1 (probe H4-1 p3-1); testis-specific protein TPX-1; cysteine rich secretory protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttactaccggtgttgtttctggttactgtgctgcttccatctttacctgcagaaggaaaggatcccgcttttactgctttgttaaccacccagttgcaagtgcaaagggagattgtaaataaacacaatgaactaaggaaagcagtctctccacctgccagtaacatgctaaagatggaatggagcagagaggtaacaacgaatgcccaaaggtgggcaaacaagtgcactttacaacatagtgatccagaggaccgcaaaaccagtacaagatgtggtgagaatctctatatgtcaagtgaccctacttcctggtcttctgcaatccaaagctggtatgacgagatcctagattttgtctatggtgtaggaccaaagagtcccaatgcagttgttggacattatactcagcttgtttggtactcgacttaccaggtaggctgtggaattgcctactgtcccaatcaagatagtctaaaatactactatgtttgccaatattgtcctgctggtaataatatgaatagaaagaataccccgtaccaacaaggaacaccttgtgccggttgccctgatgactgtgacaaaggactatgcaccaatagttgccagtatcaagatctcctaagtaactgtgattccttgaagaatacagctggctgtgaacatgagttactcaaggaaaagtgcaaggctacttgcctatgtgagaacaaaatttactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 61
- gap junction protein, beta 3, 31kDa
- tetratricopeptide repeat domain 35
- zinc finger CCCH-type containing 8

Buy CRISP2-cysteine-rich secretory protein 2 Gene now

Add to cart