Login to display prices
Login to display prices
ACAD10-acyl-Coenzyme A dehydrogenase family, member 10 Gene View larger

ACAD10-acyl-Coenzyme A dehydrogenase family, member 10 Gene

PTXBC015056

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAD10-acyl-Coenzyme A dehydrogenase family, member 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACAD10-acyl-Coenzyme A dehydrogenase family, member 10 Gene

Proteogenix catalog: PTXBC015056
Ncbi symbol: ACAD10
Product name: ACAD10-acyl-Coenzyme A dehydrogenase family, member 10 Gene
Size: 2ug
Accessions: BC015056
Gene id: 80724
Gene description: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: acyl-CoA dehydrogenase family member 10; ACAD-10; acyl-Coenzyme A dehydrogenase family, member 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggagttctcattccttctccagggagagtcgctgcagaatgggaggtacagaatcgtatcccttctggaactatattaaaggccttgatggaaggtggtgaaaatgggccctggatgagatttatgagagcagaaataacagcagagggttttttacgagaatttgggagactttgctctgaaatgttaaagacctccgtgcctgtggactcatttttctctctgttgaccagtgagcgagtggcaaagcagttcccagtgatgactgaggccataactcaaattcgggcaaaaggtcttcagactgcagtcttgagcaataatttttatcttcccaaccagaaaagctttttgcccctggaccggaaacagtttgatgtgattgtggagtcctgcatggaagggatctgtaagccagaccctaggatctacaagctgtgcttggagcagctcggcctgcagccctctgagtccatctttcttgatgaccttggaacaaatctaaaagaagctgccagacttggtattcacaccattaaggttaatgacccagagactgcagtaaaggaattagaagctctcttgggttttacattgagagtaggtgttccaaacactcggcctgtgaaaaagacgatggaaattccgaaagattccttgcagaagtacctcaaagacttactgggtatccagaccacaggattatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: