Login to display prices
Login to display prices
EXOC7-exocyst complex component 7 Gene View larger

EXOC7-exocyst complex component 7 Gene

PTXBC015165

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOC7-exocyst complex component 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOC7-exocyst complex component 7 Gene

Proteogenix catalog: PTXBC015165
Ncbi symbol: EXOC7
Product name: EXOC7-exocyst complex component 7 Gene
Size: 2ug
Accessions: BC015165
Gene id: 23265
Gene description: exocyst complex component 7
Synonyms: 2-5-3p; EX070; EXO70; EXOC1; Exo70p; YJL085W; exocyst complex component 7; exocyst complex component Exo70
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggccctgggttgccgtgctctcgctgttcccctctcggggctgggctggggccgctcttggccccaaggttgccccgggccagcagcccagccagcagcacagtctctatggtgctgaggaagagcagcagcagcaggatggtgaagtagtaaactgggggaggcagggcacagggagatgctcaggggccagtccctgtgtctctggtgcccagcgagctgagcaccagtgggtgaccggggagaaacagggcagactgggtaagggagcagggcttactgagcagtgggttgcaggaggaggagctgggcagggcctgcaccagggaggagtggaggacgaggtaactcagcagcaatgtcaccttgtagcctatgcgctcaatggcccggaggggcagcaaccccccgcacacgtcagccaacagcagtgcctctgcaggcaccaagagagcgatgatggacttgagcgccgtgttcttcagcctcagctggaaggggaaaagtcagggccttcccggcgggggggaaggaggtgggcatcgggggcatggggcctggcctctggccgtgcatcctcactcccacccgcctccagcagccctctgtcggcctcctcgcgacttgactcaccgtcacctggaagcagggcaccagctgctggggtgggacttgggtcttcagatcataaactacgtattccctcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: