Login to display prices
Login to display prices
TMEM109-transmembrane protein 109 Gene View larger

TMEM109-transmembrane protein 109 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM109-transmembrane protein 109 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM109-transmembrane protein 109 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001309
Product type: DNA & cDNA
Ncbi symbol: TMEM109
Origin species: Human
Product name: TMEM109-transmembrane protein 109 Gene
Size: 2ug
Accessions: BC001309
Gene id: 79073
Gene description: transmembrane protein 109
Synonyms: transmembrane protein 109; mg23; mitsugumin-23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcctccagcatcagttcaccatggggaaagcatgtgttcaaagccattctgatggtcctagtggcccttatcctcctccactcagcattggcccagtcccgtcgagactttgcaccaccaggccaacagaagagagaagccccagttgatgtcttgacccagataggtcgatctgtgcgagggacactggatgcctggattgggccagagaccatgcacctggtgtcagagtcttcgtcccaagtgttgtgggccatctcatcagccatttctgtggccttctttgctctgtctgggatcgccgcacagctgctgaatgccttgggactagctggtgattacctcgcccagggcctgaagctcagccctggccaggtccagaccttcctgctgtggggagcaggggccctggtcgtctactggctgctgtctctgctcctcggcttggtcttggccttgctggggcggatcctgtggggcctgaagcttgtcatcttcctggccggcttcgtggccctgatgaggtcggtgcctgacccttccacccgggccctgctactcctggccttgctgatcctctacgccctgctgagccggctcactggctcccgagcctctggggcccaactcgaggccaaggtgcgagggctggaacgccaggtggaggagctgcgctggcgccagaggcgagcggccaagggggcccgcagtgtggaggaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyltransferase like 7A
- fibroblast growth factor 13
- lin-37 homolog (C. elegans)
- transmembrane protein 192