METTL7A-methyltransferase like 7A Gene View larger

METTL7A-methyltransferase like 7A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL7A-methyltransferase like 7A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about METTL7A-methyltransferase like 7A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004492
Product type: DNA & cDNA
Ncbi symbol: METTL7A
Origin species: Human
Product name: METTL7A-methyltransferase like 7A Gene
Size: 2ug
Accessions: BC004492
Gene id: 25840
Gene description: methyltransferase like 7A
Synonyms: AAM-B; methyltransferase-like protein 7A; protein AAM-B; methyltransferase like 7A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcttaccatctttatcctgagactggccatttacatcctgacatttcccttgtacctgctgaactttctgggcttgtggagctggatatgcaaaaaatggttcccctacttcttggtgaggttcactgtgatatacaacgaacagatggcaagcaagaagcgggagctcttcagtaacctgcaggagtttgcgggcccctccgggaaactctccctgctggaagtgggctgtggcacgggggccaacttcaagttctacccacctgggtgcagggtgacctgtattgaccccaaccccaactttgagaagtttttgatcaagagcattgcagagaaccgacacctgcagtttgagcgctttgtggtagctgccggggagaacatgcaccaggtggctgatggctctgtggatgtggtggtctgcaccctggtgctgtgctctgtgaagaaccaggagcggattctccgcgaggtgtgcagagtgctgagaccgggaggggctttctatttcatggagcatgtggcagctgagtgttcgacttggaattacttctggcaacaagtcctggatcctgcctggcaccttctgtttgatgggtgcaacctgaccagagagagctggaaggccctggagcgggccagcttctctaagctgaagctgcagcacatccaggccccactgtcctgggagttggtgcgccctcatatctatggatatgctgtgaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor 13
- lin-37 homolog (C. elegans)
- transmembrane protein 192
- catechol-O-methyltransferase

Buy METTL7A-methyltransferase like 7A Gene now

Add to cart