Login to display prices
Login to display prices
METTL7A-methyltransferase like 7A Gene View larger

METTL7A-methyltransferase like 7A Gene

PTXBC004492

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL7A-methyltransferase like 7A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about METTL7A-methyltransferase like 7A Gene

Proteogenix catalog: PTXBC004492
Ncbi symbol: METTL7A
Product name: METTL7A-methyltransferase like 7A Gene
Size: 2ug
Accessions: BC004492
Gene id: 25840
Gene description: methyltransferase like 7A
Synonyms: AAM-B; methyltransferase-like protein 7A; protein AAM-B; methyltransferase like 7A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcttaccatctttatcctgagactggccatttacatcctgacatttcccttgtacctgctgaactttctgggcttgtggagctggatatgcaaaaaatggttcccctacttcttggtgaggttcactgtgatatacaacgaacagatggcaagcaagaagcgggagctcttcagtaacctgcaggagtttgcgggcccctccgggaaactctccctgctggaagtgggctgtggcacgggggccaacttcaagttctacccacctgggtgcagggtgacctgtattgaccccaaccccaactttgagaagtttttgatcaagagcattgcagagaaccgacacctgcagtttgagcgctttgtggtagctgccggggagaacatgcaccaggtggctgatggctctgtggatgtggtggtctgcaccctggtgctgtgctctgtgaagaaccaggagcggattctccgcgaggtgtgcagagtgctgagaccgggaggggctttctatttcatggagcatgtggcagctgagtgttcgacttggaattacttctggcaacaagtcctggatcctgcctggcaccttctgtttgatgggtgcaacctgaccagagagagctggaaggccctggagcgggccagcttctctaagctgaagctgcagcacatccaggccccactgtcctgggagttggtgcgccctcatatctatggatatgctgtgaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice