Login to display prices
Login to display prices
COMT-catechol-O-methyltransferase Gene View larger

COMT-catechol-O-methyltransferase Gene

PTXBC011935

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COMT-catechol-O-methyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COMT-catechol-O-methyltransferase Gene

Proteogenix catalog: PTXBC011935
Ncbi symbol: COMT
Product name: COMT-catechol-O-methyltransferase Gene
Size: 2ug
Accessions: BC011935
Gene id: 1312
Gene description: catechol-O-methyltransferase
Synonyms: HEL-S-98n; catechol O-methyltransferase; catechol-O-methyltransferase isoform; epididymis secretory sperm binding protein Li 98n; testicular tissue protein Li 42; catechol-O-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggaggccccgcctctgctgttggcagctgtgttgctgggcctggtgctgctggtggtgctgctgctgcttctgaggcactggggctggggcctgtgccttatcggctggaacgagttcatcctgcagcccatccacaacctgctcatgggtgacaccaaggagcagcgcatcctgaaccacgtgctgcagcatgcggagcccgggaacgcacagagcgtgctggaggccattgacacctactgcgagcagaaggagtgggccatgaacgtgggcgacaagaaaggcaagatcgtggacgccgtgattcaggagcaccagccctccgtgctgctggagctgggggcctactgtggctactcagctgtgcgcatggcccgcctgctgtcaccaggggcgaggctgatcaccatcgagatcaaccccgactgtgccgccatcacccagcggatggtggatttcgctggcgtgaaggacaaggtcacccttgtggttggagcgtcccaggacatcatcccccagctgaagaagaagtatgatgtggacacactggacatggtcttcctcgaccactggaaggaccggtacctgccggacacgcttctcttggaggaatgtggcctgctgcggaaggggacagtgctactggctgacaacgtgatctgcccaggtgcgccagacttcctagcacacgtgcgcgggagcagctgctttgagtgcacacactaccaatcgttcctggaatacagggaggtggtggacggcctggagaaggccatctacaagggcccaggcagcgaagcagggccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: