Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 179,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 179,00 €
Data sheet of TMEM55B-transmembrane protein 55B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM55B-transmembrane protein 55B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020947 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM55B |
| Origin species: | Human |
| Product name: | TMEM55B-transmembrane protein 55B Gene |
| Size: | 2ug |
| Accessions: | BC020947 |
| Gene id: | 90809 |
| Gene description: | transmembrane protein 55B |
| Synonyms: | C14orf9; type 1 phosphatidylinositol 4,5-bisphosphate 4-phosphatase; ptdIns-4,5-P(2) 4-phosphatase type I; ptdIns-4,5-P2 4-Ptase I; type 1 PtdIns-4,5-P2 4-Ptase; type I phosphatidylinositol-4,5-bisphosphate 4-phosphatase; transmembrane protein 55B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcagatggagagcgttccccgctgctgtctgagcccatcgacggtggcgcgggcggcaacggtttagtggggcccggcgggagtggggctgggcccgggggaggcctgaccccctccgcaccaccgtacggagccgcatttcccccgtttcccgaggggcatccagccgtgttgcctggggaggacccacccccctattcacccttaactagcccggacagtgggagtgcccctatgatcacctgccgagtctgccaatctctcatcaacgtggaaggcaagatgcatcagcatgtagtcaaatgtggtgtctgcaatgaagccaccccaatcaagaatgcacccccagggaaaaaatatgttcgatgcccctgtaactgtctccttatctgcaaagtgacatcccaacggattgcatgccctcggccctactgcaaaagaatcatcaacctggggcctgtgcatcccggacctctgagtccagaaccccaacccatgggtgtcagggttatctgtggacattgcaagaatacttttctgtggacagagttcacagaccgcactttggcacgttgtcctcactgcaggaaagtgtcatctattgggcgcagatacacacgtaagagatgtatctgctgcttcttgcttggcttgcttttggcagtcactgccactggccttgcctttggcacatggaagcatgcacggcgatatggaggcatctatgcagcctgggcatttgtcatcctgttggctgtgctgtgtttgggccgggctctttattgggcctgtatgaaggtcagccaccctgtccagaacttctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HCLS1 associated protein X-1 - 8-oxoguanine DNA glycosylase - UCHL5 interacting protein - hydroxymethylbilane synthase |