Login to display prices
Login to display prices
OGG1-8-oxoguanine DNA glycosylase Gene View larger

OGG1-8-oxoguanine DNA glycosylase Gene

PTXBC000657

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OGG1-8-oxoguanine DNA glycosylase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OGG1-8-oxoguanine DNA glycosylase Gene

Proteogenix catalog: PTXBC000657
Ncbi symbol: OGG1
Product name: OGG1-8-oxoguanine DNA glycosylase Gene
Size: 2ug
Accessions: BC000657
Gene id: 4968
Gene description: 8-oxoguanine DNA glycosylase
Synonyms: OGG1 type 1f; HMMH; HOGG1; MUTM; OGH1; N-glycosylase/DNA lyase; 8-hydroxyguanine DNA glycosylase; AP lyase; DNA-apurinic or apyrimidinic site lyase; 8-oxoguanine DNA glycosylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgcccgcgcgcttctgcccaggcgcatggggcatcgtactctagcctccactcctgccctgtgggcctccatcccgtgccctcgctctgagctgcgcctggacctggttctgccttctggacaatctttccggtggagggagcaaagtcctgcacactggagtggtgtactagcggatcaagtatggacactgactcagactgaggagcagctccactgcactgtgtaccgaggagacaagagccaggctagcaggcccacaccagacgagctggaggccgtgcgcaagtacttccagctagatgttaccctggctcaactgtatcaccactggggttccgtggactcccacttccaagaggtggctcagaaattccaaggtgtgcgactgctgcgacaagaccccatcgaatgccttttctcttttatctgttcctccaacaacaacatcgcccgcatcactggcatggtggagcggctgtgccaggcttttggacctcggctcatccagcttgatgatgtcacctaccatggcttccccagcctgcaggccctggctgggccagaggtggaggctcatctcaggaagctgggcctgggctatcgtgcccgttacgtgagtgccagtgcccgagccatcctggaagaacagggcgggctagcctggctgcagcagctacgagagtcctcatatgaggaggcccacaaggccctctgcatcctgcctggagtgggcaccaaggtggctgactgcatctgcctgatggccctagacaagccccaggctgtgcccgtggatgtccatatgtggcacattgcccaacgtgactacagctggcaccctaccacgtcccaggcgaagggaccgagcccccagaccaacaaggaactgggaaactttttccggagcctgtggggaccttatgctggctgggcccaagcggtgctgttcagtgccgacctgcgccaatgccgccatgctcaggagccaccagcaaagcgcagaaagggttccaaagggccggaaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: