Login to display prices
Login to display prices
DPH1-DPH1 homolog (S. cerevisiae) Gene View larger

DPH1-DPH1 homolog (S. cerevisiae) Gene

PTXBC003099

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPH1-DPH1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPH1-DPH1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC003099
Ncbi symbol: DPH1
Product name: DPH1-DPH1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003099
Gene id: 1801
Gene description: DPH1 homolog (S. cerevisiae)
Synonyms: DPH1 homolog; DEDSSH; DPH2L; DPH2L1; OVCA1; diphthamide biosynthesis protein 1; DPH-like 1; DPH2-like 1; candidate tumor suppressor in ovarian cancer 1; diphthamide biosynthesis protein 2 homolog-like 1; diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 1; ovarian cancer-associated gene 1 protein; ovarian tumor suppressor candidate 1; diphthamide biosynthesis 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggaaggcctcctcctctttgcctgtaccattgtggatatcttggaaaggttcacggaggccgaagtgatggtgatgggtgacgtgacctacggggcttgctgtgtggatgacttcacagcgagggccctgggagctgacttcttggtgcactacggccacagttgcctgattcccatggacacctcggcccaagacttccgggtgctgtacgtctttgtggacatccggatagacactacacacctcctggactctctccgcctcacctttcccccagccactgcccttgccctggtcagcaccattcagtttgtgtcgaccttgcaggcagccgcccaggagctgaaagccgagtatcgtgtgagtgtcccacagtgcaagcccctgtcccctggagagatcctgggctgcacatccccccgactgtccaaagaggtggaggccgttgtgtatcttggagatggccgcttccatctggagtctgtcatgattgccaaccccaatgtccccgcttaccggtatgacccatatagcaaagtcctatccagagaacactatgaccaccagcgcatgcaggctgctcgccaagaagccatagccactgcccgctcagctaagtcctggggccttattctgggcactttgggccgccagggcagtcctaagatcctggagcacctggaatctcgactccgagccttgggcctttcctttgtgaggctgctgctctctgagatcttccccagcaagcttagcctacttcccgaggtggatgtgtgggtgcaggtggcatgtccacgtctctccattgactggggcacagccttccccaagccgctgctgacaccctatgaggcggccgtggctctgagggacatttcctggcagcagccctacccgatggacttctacgctggcagctccttggggccctggacggtgaaccacggccaggaccgccgtccccacgccccgggccggcccgcgcgggggaaggtgcaggaggggtccgcgcgtcccccttcggccgtggcttgcgaggactgcagctgcagggacgagaaggtggcgccgctggctccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: