Login to display prices
Login to display prices
CPB2-carboxypeptidase B2 (plasma) Gene View larger

CPB2-carboxypeptidase B2 (plasma) Gene

PTXBC007057

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPB2-carboxypeptidase B2 (plasma) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPB2-carboxypeptidase B2 (plasma) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007057
Product type: DNA & cDNA
Ncbi symbol: CPB2
Origin species: Human
Product name: CPB2-carboxypeptidase B2 (plasma) Gene
Size: 2ug
Accessions: BC007057
Gene id: 1361
Gene description: carboxypeptidase B2 (plasma)
Synonyms: CPU; PCPB; TAFI; carboxypeptidase B2; carboxypeptidase B-like protein; carboxypeptidase B2 (plasma); carboxypeptidase B2 (plasma, carboxypeptidase U); carboxypeptidase R; thrombin-activable fibrinolysis inhibitor; thrombin-activatable fibrinolysis inhibitor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctttgcagccttgcagtccttgtacccattgttctcttctgtgagcagcatgtcttcgcgtttcagagtggccaagttctagctgctcttcctagaacctctaggcaagttcaagttctacagaatcttactacaacatatgagattgttctctggcagccggtaacagctgaccttattgtgaagaaaaaacaagtccatttttttgtaaatgcatctgatgtcgacaatgtgaaagcccatttaaatgtgagcggaattccatgcagtgtcttgctggcagacgtggaagatcttattcaacagcagatttccaacgacacagtcagcccccgagcctccgcatcgtactatgaacagtatcactcactaaatgaaatctattcttggatagaatttataactgagaggcatcctgatatgcttacaaaaatccacattggatcctcatttgagaagtacccactctatgttttaaaggtttctggaaaagaacaagcagccaaaaatgccatatggattgactgtggaatccatgccagagaatggatctctcctgctttctgcttgtggttcataggccatataactcaattctatgggataatagggcaatataccaatctcctgaggcttgtggatttctatgttatgccggtggttaatgtggatggttatgactactcatggaaaaagaatcgaatgtggagaaagaaccgttctttctatgcgaacaatcattgcatcggaacagacctgaataggaactttgcttccaaacactggtgtgaggaaggtgcatccagttcctcatgctcggaaacctactgtggactttatcctgagtcagaaccagaagtgaaggcagtggctagtttcttgagaagaaatatcaaccagattaaagcatacatcagcatgcattcatactcccagcatatagtgtttccatattcctatacacgaagtaaaagcaaagaccatgaggaactgtctctagtagccagtgaagcagttcgtgctattgagaaaactagtaaaaataccaggtatacacatggccatggctcagaaaccttatacctagctcctggaggtggggacgattggatctatgatttgggcatcaaatattcgtttacaattgaacttcgagatacgggcacatacggattcttgctgccggagcgttacatcaaacccacctgtagagaagcttttgccgctgtctctaaaatagcttggcatgtcattaggaatgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GDP dissociation inhibitor 2
- THUMP domain containing 3
- death inducer-obliterator 1
- GRAM domain containing 1C