GDI2-GDP dissociation inhibitor 2 Gene View larger

GDI2-GDP dissociation inhibitor 2 Gene

PTXBC005145

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDI2-GDP dissociation inhibitor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDI2-GDP dissociation inhibitor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005145
Product type: DNA & cDNA
Ncbi symbol: GDI2
Origin species: Human
Product name: GDI2-GDP dissociation inhibitor 2 Gene
Size: 2ug
Accessions: BC005145
Gene id: 2665
Gene description: GDP dissociation inhibitor 2
Synonyms: HEL-S-46e; RABGDIB; rab GDP dissociation inhibitor beta; GDI-2; epididymis secretory sperm binding protein Li 46e; guanosine diphosphate dissociation inhibitor 2; rab GDI beta; rab GDP-dissociation inhibitor, beta; GDP dissociation inhibitor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgaggagtacgacgtgatcgtgctgggcaccggcctgacggaatgtatcctgtcaggtataatgtcagtgaatggcaagaaagttcttcatatggatcgaaacccttactacggaggagagagtgcatctataacaccattggaagatttatacaaaagatttaaaataccaggatcaccacccgagtcaatggggagaggaagagactggaatgttgacttgattcccaagttccttatggctaatggtcagctggttaagatgctgctttatacagaggtaactcgctatctggattttaaagtgactgaagggagctttgtctataagggtggaaaaatctacaaggttccttccactgaagcagaagccctggcatctagcctaatgggattgtttgaaaaacgtcgcttcaggaaattcctagtgtatgttgccaacttcgatgaaaaagatccaagaacttttgaaggcattgatcctaagaagaccacaatgcgagatgtgtataagaaatttgatttgggtcaagacgttatagattttactggtcatgctcttgcactttacagaactgatgattacttagatcaaccgtgttatgaaaccattaatagaattaaactttacagtgaatctttggcaagatatggcaaaagcccatacctttatccactctatggccttggagaactgccccaaggatttgcaaggctaagtgctatttatggaggtacctatatgctgaataaacccattgaagaaatcattgtacagaatggaaaagtaattggtgtaaaatctgaaggagaaattgctcgctgtaagcagctcatctgtgaccccagctacgtaaaagatcgggtagaaaaagtgggccaggtgatcagagttatttgcatcctcagccaccccatcaagaacaccaatgatgccaactcctgccagatcattattccacagaaccaagtcaatcgaaagtcagatatctacgtctgcatgatctcctttgcgcacaatgtagcagcacaagggaagtacattgctatagttagtacaactgtggaaaccaaggagcctgagaaggaaatcagaccagctttggagctcttggaaccaattgaacagaaatttgttagcatcagtgacctcctggtaccaaaagacttgggaacagaaagccagatctttatttcccgcacatatgatgccaccactcattttgagacaacgtgtgatgacattaaaaacatctataagaggatgacaggatcagagtttgactttgaggaaatgaagcgcaagaagaatgacatctatggggaagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THUMP domain containing 3
- death inducer-obliterator 1
- GRAM domain containing 1C
- exocyst complex component 7

Buy GDI2-GDP dissociation inhibitor 2 Gene now

Add to cart