Login to display prices
Login to display prices
HMBS-hydroxymethylbilane synthase Gene View larger

HMBS-hydroxymethylbilane synthase Gene

PTXBC000520

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMBS-hydroxymethylbilane synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HMBS-hydroxymethylbilane synthase Gene

Proteogenix catalog: PTXBC000520
Ncbi symbol: HMBS
Product name: HMBS-hydroxymethylbilane synthase Gene
Size: 2ug
Accessions: BC000520
Gene id: 3145
Gene description: hydroxymethylbilane synthase
Synonyms: PBG-D; PBGD; PORC; UPS; porphobilinogen deaminase; porphyria, acute; Chester type; pre-uroporphyrinogen synthase; uroporphyrinogen I synthase; uroporphyrinogen I synthetase; hydroxymethylbilane synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggtaacggcaatgcggctgcaacggcggaagaaaacagcccaaagatgagagtgattcgcgtgggtacccgcaagagccagcttgctcgcatacagacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatcattgctatgtccaccacaggggacaagattcttgatactgcactctctaagattggagagaaaagcctgtttaccaaggagcttgaacatgccctggagaagaatgaagtggacctggttgttcactccttgaaggacctgcccactgtgcttcctcctggcttcaccatcggagccatctgcaagcgggaaaaccctcatgatgctgttgtctttcacccaaaatttgttgggaagaccctagaaaccctgccagagaagagtgtggtgggaaccagctccctgcgaagagcagcccagctgcagagaaagttcccgcatctggagttcaggagtattcggggaaacctcaacacccggcttcggaagctggacgagcagcaggagttcagtgccatcatcctggcaacagctggcctgcagcgcatgggctggcacaaccgggtggggcagatcctgcaccctgaggaatgcatgtatgctgtgggccagggggccttgggcgtggaagtgcgagccaaggaccaggacatcttggatctggtgggtgtgctgcacgatcccgagactctgcttcgctgcatcgctgaaagggccttcctgaggcacctggaaggaggctgcagtgtgccagtagccgtgcatacagctatgaaggatgggcaactgtacctgactggaggagtctggagtctagacggctcagatagcatacaagagaccatgcaggctaccatccatgtccctgcccagcatgaagatggccctgaggatgacccacagttggtaggcatcactgctcgtaacattccacgagggccccagttggctgcccagaacttgggcatcagcctggccaacttgttgctgagcaaaggagccaaaaacatcctggatgttgcacggcagcttaacgatgcccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: