UCHL5IP-UCHL5 interacting protein Gene View larger

UCHL5IP-UCHL5 interacting protein Gene

PTXBC008141

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCHL5IP-UCHL5 interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UCHL5IP-UCHL5 interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008141
Product type: DNA & cDNA
Ncbi symbol: UCHL5IP
Origin species: Human
Product name: UCHL5IP-UCHL5 interacting protein Gene
Size: 2ug
Accessions: BC008141
Gene id: 55559
Gene description: UCHL5 interacting protein
Synonyms: UCHL5IP; UIP1; HAUS augmin-like complex subunit 7; 26S proteasome-associated UCH37-interacting protein 1; UCHL5 interacting protein; X-linked protein STS1769; HAUS augmin like complex subunit 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggggcaggacgctggctgcggccgtggcggcgacgactactcagaggacgagggcgacagcagcgtgtccagggcggctgtggaggtgttcgggaagctgaaggacctaaactgccccttcctcgagggtctgtatatcacagagccaaagacaattcaggaactgctgtgcagcccctcagagtaccgcttggagatcctagagtggatgtgtacccgggtctggccctcactgcaggacaggttcagctcactgaaaggggtcccaacagaggtgaagatccaagaaatgacgaagctgggccacgagctgatgctgtgtgcgccagatgaccaggagctcctcaagggctgtgcctgcgcccagaagcagctacacttcatggaccagttgctcgataccatccggagcctgaccattgggtgctccagttgctcgagcctgatggagcacttcgaggacaccagggagaagaacgaggccttgctgggggagctcttctctagcccccacctgcagatgctcctgaatccagagtgcgacccgtggcccctggacatgcagcccctcctcaacaagcagagtgatgactggcagtgggccagtgcctctgccaagtccgaggaggaggagaagctggcggagcttgccaggcagctgcaggagagtgctgccaagttgcacgcgcttagaacggagtactttgcacagcatgagcaaggggctgctgcgggcgcagccgacatcagcaccctagaccagaagctgcgtctggtcacttccgacttccaccagctaatcttggcttttctccaagtctacgacgacgagctgggcgagtgctgccagcgcccaggccctgacctccacccgtgcggccccatcatccaggccacgcaccagaatctgacttcctacagccaactgctgcaagtggtcatggcagttgctgacacctctgcgaaggccgtggagaccgtgaagaagcagcaaggcgagcagatctgctggggtggcagcagctccgtcatgagtctagctaccaagatgaatgaactaatggagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxymethylbilane synthase
- DPH1 homolog (S. cerevisiae)
- MTERF domain containing 1
- carboxypeptidase B2 (plasma)

Buy UCHL5IP-UCHL5 interacting protein Gene now

Add to cart