Login to display prices
Login to display prices
TMEM45A-transmembrane protein 45A Gene View larger

TMEM45A-transmembrane protein 45A Gene

PTXBC040355

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM45A-transmembrane protein 45A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM45A-transmembrane protein 45A Gene

Proteogenix catalog: PTXBC040355
Ncbi symbol: TMEM45A
Product name: TMEM45A-transmembrane protein 45A Gene
Size: 2ug
Accessions: BC040355
Gene id: 55076
Gene description: transmembrane protein 45A
Synonyms: DERP7; DNAPTP4; transmembrane protein 45A; DNA polymerase-transactivated protein 4; dermal papilla derived protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaatttcagaggtcatgccctccctggaaccttcttttttattattggtctttggtggtgtacaaagagtattctgaagtatatctgcaaaaagcaaaagcgaacctgctatcttggttccaaaacattattctatcgattggaaattttggagggaattacaatagttggcatggctttaactggcatggctggggagcagtttattcctggagggccccatctgatgttatatgactataaacaaggtcactggaatcaactcctgggctggcatcatttcaccatgtatttcttctttgggctgttgggtgtggcagatatcttatgtttcaccatcagttcacttcctgtgtccttaaccaagttaatgttgtcaaatgccttatttgtggaggcctttatcttctacaaccacactcatggccgggaaatgctggacatctttgtgcaccagctgctggttttggtcgtctttctgacaggcctcgttgccttcctagagttccttgttcggaacaatgtacttctggagctattgcggtcaagtctcattctgcttcaggggagctggttctttcagattggatttgtcctgtatccccccagtggaggtcctgcatgggatctgatggatcatgaaaatattttgtttctcaccatatgcttttgttggcattatgcagtaaccattgtcatcgttggaatgaattatgctttcattacctggttggttaaatctagacttaagaggctctgctcctcagaagttggacttctgaaaaatgctgaacgagaacaagaatcagaagaagaaatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: