LIN37-lin-37 homolog (C. elegans) Gene View larger

LIN37-lin-37 homolog (C. elegans) Gene

PTXBC009071

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LIN37-lin-37 homolog (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LIN37-lin-37 homolog (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009071
Product type: DNA & cDNA
Ncbi symbol: LIN37
Origin species: Human
Product name: LIN37-lin-37 homolog (C. elegans) Gene
Size: 2ug
Accessions: BC009071
Gene id: 55957
Gene description: lin-37 homolog (C. elegans)
Synonyms: F25965; ZK418.4; lin-37; protein lin-37 homolog; antolefinin; lin-37 homolog; protein F25965; lin-37 DREAM MuvB core complex component
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccctgtgaaggtgaaagtggagaaatcagagctggagatggccaaagcccggaaccaactggatgctgtcttgcagtgtctgctggagaagagtcacatggacagggagcgtctggatgaggaagctgggaaaacaccctcagacacccacaataaggactgctccatcgcagccactggcaaaaggccatctgcccgcttcccccaccagcggaggaagaagaggagggagatggatgatgggctggctgagggagggccgcagcgatccaacacatatgtgatcaagctgttcgaccggagcgtggacttggcccagttcagcgagaacacgccactgtacccaatctgccgcgcctggatgcgcaacagcccctctgtgcgcgagcgtgaatgctctcccagctcacccctgcccccgctgcctgaggatgaggagggctcagaggtaaccaacagcaagagtcgtgatgtgtacaagctgccgccacccacacccccggggccacccggagatgcctgcagatcccgcatcccatctccactgcagcctgagatgcagggcacccctgacgatgagccctctgagcccgagccctcaccctccacactcatctatcgcaacatgcagcgctggaaacgcatccgccagaggtggaaggaggcctctcatcggaaccagcttcgttactcagaaagcatgaagatcctacgagagatgtacgaacgacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 192
- catechol-O-methyltransferase
- potassium channel regulator
- transmembrane protein 45A

Buy LIN37-lin-37 homolog (C. elegans) Gene now

Add to cart