FGF13-fibroblast growth factor 13 Gene View larger

FGF13-fibroblast growth factor 13 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF13-fibroblast growth factor 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGF13-fibroblast growth factor 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012347
Product type: DNA & cDNA
Ncbi symbol: FGF13
Origin species: Human
Product name: FGF13-fibroblast growth factor 13 Gene
Size: 2ug
Accessions: BC012347
Gene id: 2258
Gene description: fibroblast growth factor 13
Synonyms: FGF-13; FGF2; FHF-2; FHF2; fibroblast growth factor 13; fibroblast growth factor homologous factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggctatcgccagctcgctcatccgtcagaagaggcaagcccgcgagcgcgagaaatccaacgcctgcaagtgtgtcagcagccccagcaaaggcaagaccagctgcgacaaaaacaagttaaatgtcttttcccgggtcaaactcttcggctccaagaagaggcgcagaagaagaccagagcctcagcttaagggtatagttaccaagctatacagccgacaaggctaccacttgcagctgcaggcggatggaaccattgatggcaccaaagatgaggacagcacttacactctgtttaacctcatccctgtgggtctgcgagtggtggctatccaaggagttcaaaccaagctgtacttggcaatgaacagtgagggatacttgtacacctcggaacttttcacacctgagtgcaaattcaaagaatcagtgtttgaaaattattatgtgacatattcatcaatgatataccgtcagcagcagtcaggccgagggtggtatctgggtctgaacaaagaaggagagatcatgaaaggcaaccatgtgaagaagaacaagcctgcagctcattttctgcctaaaccactgaaagtggccatgtacaaggagccatcactgcacgatctcacggagttctcccgatctggaagcgggaccccaaccaagagcagaagtgtctctggcgtgctgaacggaggcaaatccatgagccacaatgaatcaacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lin-37 homolog (C. elegans)
- transmembrane protein 192
- catechol-O-methyltransferase
- potassium channel regulator

Buy FGF13-fibroblast growth factor 13 Gene now

Add to cart