Login to display prices
Login to display prices
FGF13-fibroblast growth factor 13 Gene View larger

FGF13-fibroblast growth factor 13 Gene

PTXBC012347

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF13-fibroblast growth factor 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FGF13-fibroblast growth factor 13 Gene

Proteogenix catalog: PTXBC012347
Ncbi symbol: FGF13
Product name: FGF13-fibroblast growth factor 13 Gene
Size: 2ug
Accessions: BC012347
Gene id: 2258
Gene description: fibroblast growth factor 13
Synonyms: FGF-13; FGF2; FHF-2; FHF2; fibroblast growth factor 13; fibroblast growth factor homologous factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggctatcgccagctcgctcatccgtcagaagaggcaagcccgcgagcgcgagaaatccaacgcctgcaagtgtgtcagcagccccagcaaaggcaagaccagctgcgacaaaaacaagttaaatgtcttttcccgggtcaaactcttcggctccaagaagaggcgcagaagaagaccagagcctcagcttaagggtatagttaccaagctatacagccgacaaggctaccacttgcagctgcaggcggatggaaccattgatggcaccaaagatgaggacagcacttacactctgtttaacctcatccctgtgggtctgcgagtggtggctatccaaggagttcaaaccaagctgtacttggcaatgaacagtgagggatacttgtacacctcggaacttttcacacctgagtgcaaattcaaagaatcagtgtttgaaaattattatgtgacatattcatcaatgatataccgtcagcagcagtcaggccgagggtggtatctgggtctgaacaaagaaggagagatcatgaaaggcaaccatgtgaagaagaacaagcctgcagctcattttctgcctaaaccactgaaagtggccatgtacaaggagccatcactgcacgatctcacggagttctcccgatctggaagcgggaccccaaccaagagcagaagtgtctctggcgtgctgaacggaggcaaatccatgagccacaatgaatcaacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: