Login to display prices
Login to display prices
ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene View larger

ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene

PTXBC009712

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene

Proteogenix catalog: PTXBC009712
Ncbi symbol: ABCD3
Product name: ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene
Size: 2ug
Accessions: BC009712
Gene id: 5825
Gene description: ATP-binding cassette, sub-family D (ALD), member 3
Synonyms: ABC43; CBAS5; PMP70; PXMP1; ZWS2; ATP-binding cassette sub-family D member 3; 70 kDa peroxisomal membrane protein; ATP-binding cassette, sub-family D (ALD), member 3; Peroxisomal membrane protein-1 (70kD); dJ824O18.1 (ATP-binding cassette, sub-family D (ALD), member 3 (PMP70, PXMP1)); peroxisomal membrane protein 1 (70kD, Zellweger syndrome); ATP binding cassette subfamily D member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtggtggacaaggtgtttttctcaaggctcatacagattctgaaaatcatggtccctagaacattttgtaaagagacaggttacttggtacttattgctgttatgctggtgtctcgaacatattgtgatgtttggatgattcaaaatgggacactaattgaaagtggtatcattggtcgtagcaggaaagatttcaagagatacttactcaacttcatcgctgccatgcctcttatctctctggttaataacttcttgaagtatgggttaaatgagcttaaactgtgcttccgagtaaggctcactaaatacctctatgaggagtatcttcaagctttcacatattataaaatggggaatctggacaacagaatagctaatccagaccagctgcttacacaagatgtagaaaaattttgtaacagtgtagtcgatctgtattcaaatcttagtaagccatttttagacatagttttgtatatctttaagttaacgagtgcaattggagctcaggtacttggaaaaattttgtggcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: