ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene View larger

ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009712
Product type: DNA & cDNA
Ncbi symbol: ABCD3
Origin species: Human
Product name: ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene
Size: 2ug
Accessions: BC009712
Gene id: 5825
Gene description: ATP-binding cassette, sub-family D (ALD), member 3
Synonyms: ABC43; CBAS5; PMP70; PXMP1; ZWS2; ATP-binding cassette sub-family D member 3; 70 kDa peroxisomal membrane protein; ATP-binding cassette, sub-family D (ALD), member 3; Peroxisomal membrane protein-1 (70kD); dJ824O18.1 (ATP-binding cassette, sub-family D (ALD), member 3 (PMP70, PXMP1)); peroxisomal membrane protein 1 (70kD, Zellweger syndrome); ATP binding cassette subfamily D member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtggtggacaaggtgtttttctcaaggctcatacagattctgaaaatcatggtccctagaacattttgtaaagagacaggttacttggtacttattgctgttatgctggtgtctcgaacatattgtgatgtttggatgattcaaaatgggacactaattgaaagtggtatcattggtcgtagcaggaaagatttcaagagatacttactcaacttcatcgctgccatgcctcttatctctctggttaataacttcttgaagtatgggttaaatgagcttaaactgtgcttccgagtaaggctcactaaatacctctatgaggagtatcttcaagctttcacatattataaaatggggaatctggacaacagaatagctaatccagaccagctgcttacacaagatgtagaaaaattttgtaacagtgtagtcgatctgtattcaaatcttagtaagccatttttagacatagttttgtatatctttaagttaacgagtgcaattggagctcaggtacttggaaaaattttgtggcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ORAI calcium release-activated calcium modulator 1
- mitochondrial translational release factor 1-like
- GTP binding protein overexpressed in skeletal muscle
- activating signal cointegrator 1 complex subunit 1

Buy ABCD3-ATP-binding cassette, sub-family D (ALD), member 3 Gene now

Add to cart