Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009850 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC34 |
| Origin species: | Human |
| Product name: | CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC009850 |
| Gene id: | 997 |
| Gene description: | cell division cycle 34 homolog (S. cerevisiae) |
| Synonyms: | ubiquitin-conjugating enzyme E2-CDC34; E2-CDC34; UBC3; UBCH3; UBE2R1; ubiquitin-conjugating enzyme E2 R1; (E3-independent) E2 ubiquitin-conjugating enzyme R1; E2 ubiquitin-conjugating enzyme R1; cell division cycle 34 homolog; ubiquitin carrier protein; ubiquitin-conjugating enzyme E2-32 KDA complementing; ubiquitin-protein ligase R1; cell division cycle 34 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcggccgctagtgcccagctcgcagaaggcgctgctgctggagctcaaggggctgcaggaagagccggtcgagggattccgcgtgacactggtggacgagggcgatctatacaactgggaggtggccatcttcgggccccccaacacctactacgagggcggctacttcaaggcgcgcctcaagttccccatcgactacccatactctccaccagcctttcggttcctgaccaagatgtggcaccctaacatctacgagacgggggacgtgtgtatctccatcctccacccgccggtggacgacccccagagcggggagctgccctcagagaggtggaaccccacgcagaacgtcaggaccattctcctgagtgtgatctccctcctgaacgagcccaacaccttctcgcccgcaaacgtggacgcctccgtgatgtacaggaagtggaaagagagcaaggggaaggatcgggagtacacagacatcatccggaagcaggtcctggggaccaaggtggacgcggagcgtgacggcgtgaaggtgcccaccacgctggccgagtactgcgtgaagaccaaggcgccggcgcccgacgagggctcagacctcttctacgacgactactacgaggacggcgaggtggaggaggaggccgacagctgcttcggggacgatgaggatgactctggcacggaggagtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complement component 1, q subcomponent, C chain - granzyme H (cathepsin G-like 2, protein h-CCPX) - Spi-C transcription factor (Spi-1/PU.1 related) - T-cell activation RhoGTPase activating protein |