CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene View larger

CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009850
Product type: DNA & cDNA
Ncbi symbol: CDC34
Origin species: Human
Product name: CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009850
Gene id: 997
Gene description: cell division cycle 34 homolog (S. cerevisiae)
Synonyms: ubiquitin-conjugating enzyme E2-CDC34; E2-CDC34; UBC3; UBCH3; UBE2R1; ubiquitin-conjugating enzyme E2 R1; (E3-independent) E2 ubiquitin-conjugating enzyme R1; E2 ubiquitin-conjugating enzyme R1; cell division cycle 34 homolog; ubiquitin carrier protein; ubiquitin-conjugating enzyme E2-32 KDA complementing; ubiquitin-protein ligase R1; cell division cycle 34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcggccgctagtgcccagctcgcagaaggcgctgctgctggagctcaaggggctgcaggaagagccggtcgagggattccgcgtgacactggtggacgagggcgatctatacaactgggaggtggccatcttcgggccccccaacacctactacgagggcggctacttcaaggcgcgcctcaagttccccatcgactacccatactctccaccagcctttcggttcctgaccaagatgtggcaccctaacatctacgagacgggggacgtgtgtatctccatcctccacccgccggtggacgacccccagagcggggagctgccctcagagaggtggaaccccacgcagaacgtcaggaccattctcctgagtgtgatctccctcctgaacgagcccaacaccttctcgcccgcaaacgtggacgcctccgtgatgtacaggaagtggaaagagagcaaggggaaggatcgggagtacacagacatcatccggaagcaggtcctggggaccaaggtggacgcggagcgtgacggcgtgaaggtgcccaccacgctggccgagtactgcgtgaagaccaaggcgccggcgcccgacgagggctcagacctcttctacgacgactactacgaggacggcgaggtggaggaggaggccgacagctgcttcggggacgatgaggatgactctggcacggaggagtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complement component 1, q subcomponent, C chain
- granzyme H (cathepsin G-like 2, protein h-CCPX)
- Spi-C transcription factor (Spi-1/PU.1 related)
- T-cell activation RhoGTPase activating protein

Buy CDC34-cell division cycle 34 homolog (S. cerevisiae) Gene now

Add to cart