SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene View larger

SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene

PTXBC032317

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032317
Product type: DNA & cDNA
Ncbi symbol: SPIC
Origin species: Human
Product name: SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene
Size: 2ug
Accessions: BC032317
Gene id: 121599
Gene description: Spi-C transcription factor (Spi-1/PU.1 related)
Synonyms: SPI-C; transcription factor Spi-C; Spi-C transcription factor (Spi-1/PU.1 related); Spi-C transcription factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgtgtgttgaacaagacaagctgggtcaagcatttgaagatgcttttgaggttctgaggcaacattcaactggagatcttcagtactcgccagattacagaaattacctggctttaatcaaccatcgtcctcatgtcaaaggaaattccagctgctatggagtgttgcctacagaggagcctgtctataattggagaacggtaattaacagtgctgcggacttctattttgaaggaaatattcatcaatctctgcagaacataactgaaaaccagctggtacaacccactcttctccagcaaaaggggggaaaaggcaggaagaagctccgactgtttgaataccttcacgaatccctgtataatccggagatggcatcttgtattcagtgggtagataaaaccaaaggcatctttcagtttgtatcaaaaaacaaagaaaaacttgccgagctttgggggaaaagaaaaggcaacaggaagaccatgacttaccagaaaatggccagggcactcagaaattacggaagaagtggggaaattaccaaaatccggaggaagctgacttaccagttcagtgaggccattctccaaagactctctccatcctatttcctggggaaagagatcttctattcacagtgtgttcaacctgatcaagaatatctcagtttaaataactggaatgcaaattataattatacatatgccaattaccatgagctaaatcaccatgattgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - T-cell activation RhoGTPase activating protein
- capping protein (actin filament), gelsolin-like
- glutamate-ammonia ligase (glutamine synthetase)
- glutamate-ammonia ligase (glutamine synthetase)

Buy SPIC-Spi-C transcription factor (Spi-1/PU.1 related) Gene now

Add to cart