Login to display prices
Login to display prices
TAGAP-T-cell activation RhoGTPase activating protein Gene View larger

TAGAP-T-cell activation RhoGTPase activating protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAGAP-T-cell activation RhoGTPase activating protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAGAP-T-cell activation RhoGTPase activating protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015859
Product type: DNA & cDNA
Ncbi symbol: TAGAP
Origin species: Human
Product name: TAGAP-T-cell activation RhoGTPase activating protein Gene
Size: 2ug
Accessions: BC015859
Gene id: 117289
Gene description: T-cell activation RhoGTPase activating protein
Synonyms: ARHGAP47; FKSG15; IDDM21; TAGAP1; T-cell activation Rho GTPase-activating protein; T-cell activation RhoGTPase activating protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgagaagcagccacaatgcttcaaaaacactaaacgccaataatatggagacactaatcgaatgtcaatcagagggtgatatcaaggaacatcccctgttggcatcatgtgagagtgaagacagtatttgccagctcattgaagttaagaagagaaagaaggtgctgtcctggccctttctcatgagaaggctctcccctgcatcagatttttctggggctttggagacagacttgaaagcatcgctatttgatcagcccttgtcaattatctgcggtgacagtgacacactccccagacccatccaggacattctcactattctatgccttaaaggcccttcaacggaagggatattcaggagagcagccaacgagaaagcccgtaaggagctgaaggaggagctcaactctggggatgcggtggatctggagaggctccccgtgcacctcctcgctgtggtctttaaggacttcctcagaagtatcccccggaagctactttcaagcgacctctttgaggagtggatgggtgctctggagatgcaggacgaggaggacagaatcgaggccctgaaacaggttgcagataagctcccccggcccaacctcctgctactcaagcacttggtctatgtgctgcacctcatcagcaagaactctgaggtgaacaggatggactccagcaatctggccatctgcattggacccaacatgctcaccctggagaatgaccagagcctgtcatttgaagcccagaaggacctgaacaacaaggtttgttctgcttactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - capping protein (actin filament), gelsolin-like
- glutamate-ammonia ligase (glutamine synthetase)
- glutamate-ammonia ligase (glutamine synthetase)
- DnaJ (Hsp40) homolog, subfamily C, member 14