Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TAGAP-T-cell activation RhoGTPase activating protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAGAP-T-cell activation RhoGTPase activating protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015859 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAGAP |
| Origin species: | Human |
| Product name: | TAGAP-T-cell activation RhoGTPase activating protein Gene |
| Size: | 2ug |
| Accessions: | BC015859 |
| Gene id: | 117289 |
| Gene description: | T-cell activation RhoGTPase activating protein |
| Synonyms: | ARHGAP47; FKSG15; IDDM21; TAGAP1; T-cell activation Rho GTPase-activating protein; T-cell activation RhoGTPase activating protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctgagaagcagccacaatgcttcaaaaacactaaacgccaataatatggagacactaatcgaatgtcaatcagagggtgatatcaaggaacatcccctgttggcatcatgtgagagtgaagacagtatttgccagctcattgaagttaagaagagaaagaaggtgctgtcctggccctttctcatgagaaggctctcccctgcatcagatttttctggggctttggagacagacttgaaagcatcgctatttgatcagcccttgtcaattatctgcggtgacagtgacacactccccagacccatccaggacattctcactattctatgccttaaaggcccttcaacggaagggatattcaggagagcagccaacgagaaagcccgtaaggagctgaaggaggagctcaactctggggatgcggtggatctggagaggctccccgtgcacctcctcgctgtggtctttaaggacttcctcagaagtatcccccggaagctactttcaagcgacctctttgaggagtggatgggtgctctggagatgcaggacgaggaggacagaatcgaggccctgaaacaggttgcagataagctcccccggcccaacctcctgctactcaagcacttggtctatgtgctgcacctcatcagcaagaactctgaggtgaacaggatggactccagcaatctggccatctgcattggacccaacatgctcaccctggagaatgaccagagcctgtcatttgaagcccagaaggacctgaacaacaaggtttgttctgcttactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - capping protein (actin filament), gelsolin-like - glutamate-ammonia ligase (glutamine synthetase) - glutamate-ammonia ligase (glutamine synthetase) - DnaJ (Hsp40) homolog, subfamily C, member 14 |