DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene View larger

DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016941
Product type: DNA & cDNA
Ncbi symbol: DNAJC14
Origin species: Human
Product name: DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene
Size: 2ug
Accessions: BC016941
Gene id: 85406
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 14
Synonyms: DNAJ; DRIP78; HDJ3; LIP6; dnaJ homolog subfamily C member 14; DnaJ (Hsp40) homolog, subfamily C, member 14; LYST-interacting protein LIP6; dnaJ protein homolog 3; dopamine receptor interacting protein; dopamine receptor-interacting protein of 78 kDa; hDj-3; human DnaJ protein 3; DnaJ heat shock protein family (Hsp40) member C14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacgaatggcagagaatgagctgagccggtcagtaaatgagtttctgtccaagctgcaagatgacctcaaggaggcaatgaatactatgatgtgtagccgatgccaaggaaagcataggaggtttgaaatggaccgggaacctaagagtgccagatactgtgctgagtgtaataggctgcatcctgctgaggaaggagacttttgggcagagtcaagcatgttgggcctcaagatcacctactttgcactgatggatggaaaggtgtatgacatcacagagtgggctggatgccagcgtgtaggtatctccccagatacccacagagtcccctatcacatctcatttggttctcggattccaggcaccagagggcggcagagagccaccccagatgcccctcctgctgatcttcaggatttcttgagtcggatctttcaagtacccccagggcagatgcccaatgggaacttctttgcagctcctcagcctgcccctggagccgctgcagcctctaagcccaacagcacagtacccaagggagaagccaaacctaagcggcggaagaaacttgccgaactaaagcaagaatgtcttgctcgtggtttggagaccaagggaataaagcaagatcttatccacagactccaggcatatcttgaagaacatgctgaagaggaggcaaatgaagaagatgtactgggagatgaaacagaggaagaagaaacaaagcccattgagctccctgtcaaagaggaagaaccccctgaaaaaactgttgatgtggcagcagagaagaaagtggtgaaaattacatctgaaataccacagactgagagaatgcagaagagggctgaacgattcaatgtacctgtgagcttggagagtaagaaagttgctcgggcagctaggtttgggatttcttcagttccaacaaaaggtctgtcatctgataacaaacctatggttaacttggataagctgaaggaaagagctcaaagatttggtttgaatgtctcttcaatctccagaaagtctgaagatgatgagaaactgaaaaagaggaaggagcgatttgggattgtcacaagttcagctggaactggaaccacagaggatacagaggcaaagaagaggaaaagagcagagcgctttgggattgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-Coenzyme A dehydrogenase family, member 8
- Tu translation elongation factor, mitochondrial
- cell division cycle 20 homolog (S. cerevisiae)
- alkaline phosphatase, placental (Regan isozyme)

Buy DNAJC14-DnaJ (Hsp40) homolog, subfamily C, member 14 Gene now

Add to cart