Login to display prices
Login to display prices
ACAD8-acyl-Coenzyme A dehydrogenase family, member 8 Gene View larger

ACAD8-acyl-Coenzyme A dehydrogenase family, member 8 Gene

PTXBC001964

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAD8-acyl-Coenzyme A dehydrogenase family, member 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACAD8-acyl-Coenzyme A dehydrogenase family, member 8 Gene

Proteogenix catalog: PTXBC001964
Ncbi symbol: ACAD8
Product name: ACAD8-acyl-Coenzyme A dehydrogenase family, member 8 Gene
Size: 2ug
Accessions: BC001964
Gene id: 27034
Gene description: acyl-Coenzyme A dehydrogenase family, member 8
Synonyms: ACAD-8; ARC42; isobutyryl-CoA dehydrogenase, mitochondrial; activator-recruited cofactor 42 kDa component; acyl-Coenzyme A dehydrogenase family, member 8; acyl-CoA dehydrogenase family member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtggagcggctgccggcgtttcggggcgcgcctcggctgcctgcccggcggtctccgggtcctcgtccagaccggccaccggagcttgacctcctgcatcgacccttccatgggacttaatgaagagcagaaagaatttcaaaaagtggcctttgactttgctgcccgagagatggctccaaatatggcagagtgggaccagaaggagctgttcccagtggatgtgatgcggaaggcagcccagctaggcttcggaggggtctacatacaaacagatgtgggcgggtctgggctgtcacgtcttgatacctctgtcatttttgaagccttggctacaggctgcaccagcaccacagcctatataagcatccacaacatgtgtgcctggatgattgatagcttcggaaatgaggaacagaggcacaaattttgcccaccgctctgtaccatggagaagtttgcttcctactgcctcactgaaccaggaagtgggagtgatgctgcctctcttctgacctccgctaagaaacagggagatcattacatcctcaatggctccaaggccttcatcagtggtgctggtgagtcagacatctatgtggtcatgtgccgaacaggaggactaggccccaagggcatctcatgcatagttgttgagaaggggacccctggcctcagctttggcaagaaggagaaaaaggtggggtggaactcccagccaacacgagctgtgatcttcgaagactgtgctgtccctgtggccaacagaattgggagcgaggggcagggcttcctcattgccgtgagaggactgaacggagggaggatcaatattgcttcctgctccctgggggctgcccacgcctctgtcatcctcacccgagaccacctcaatgtccggaagcagtttggagagcctctggccagtaaccagtacttgcaattcacactggctgatatggcaacaaggctggtggccgcgcggctgatggtccgcaatgcagcagtggctctgcaggaggagaggaaggatgcagtggccttgtgctccatggccaagctctttgctacagatgaatgctttgccatctgcaaccaggccttgcagatgcacgggggctacggctacctgaaggattacgctgttcagcagtacgtgcgggactccagggtccaccagattctagaaggtagcaatgaagtgatgaggatactgatctctagaagcctgcttcaggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: