TUFM-Tu translation elongation factor, mitochondrial Gene View larger

TUFM-Tu translation elongation factor, mitochondrial Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUFM-Tu translation elongation factor, mitochondrial Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TUFM-Tu translation elongation factor, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001633
Product type: DNA & cDNA
Ncbi symbol: TUFM
Origin species: Human
Product name: TUFM-Tu translation elongation factor, mitochondrial Gene
Size: 2ug
Accessions: BC001633
Gene id: 7284
Gene description: Tu translation elongation factor, mitochondrial
Synonyms: COXPD4; EF-TuMT; EFTU; P43; elongation factor Tu, mitochondrial; EF-Tu; Tu translation elongation factor, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgccgccggccggaccttcctgctgcagggtctgttgcggctgctgaaagccccggcattgcctctcttgtgccgcggcctggccgtggaggccaagaagacttacgtgcgcgacaagccacatgtgaatgtgggtaccatcggccatgtggaccacgggaagaccacgctgactgcagccatcacgaagattctagctgagggaggtggggctaagttcaagaagtacgaggagattgacaatgccccggaggagcgagctcggggtatcaccatcaatgcggctcatgtggagtatagcactgccgcccgccactacgcccacacagactgcccgggtcatgcagattatgttaagaatatgatcacaggcactgcacccctcgacggctgcatcctggtggtagcagccaatgacggccccatgccccagacccgagagcacttattactggccagacagattggggtggagcatgtggtggtgtatgtgaacaaggctgacgctgtccaggactctgagatggtggaactggtggaactggagatccgggagctgctcaccgagtttggctataaaggggaggagaccccagtcatcgtaggctctgctctctgtgcccttgagggtcgggaccctgagttaggcctgaagtctgtgcagaagctactggatgctgtggacacttacatcccagtgcccgcccgggacctggagaagcctttcctgctgcctgtggaggcggtgtactccgtccctggccgtggcaccgtggtgacaggtacactagagcgtggcattttaaagaagggagacgagtgtgagctcctaggacatagcaagaacatccgcactgtggtgacaggcattgagatgttccacaagagcctggagagggccgaggccggagataacctcggggccctggtccgaggcttgaagcgggaggacttgcggcggggcctggtcatggtcaagccaggttccatcaagccccaccagaaggtggaggcccaggtttacatcctcagcaaggaggaaggtggccgccacaagccctttgtgtcccacttcatgcctgtcatgttctccctgacttgggacatggcctgtcggattatcctgcccccagagaaggagcttgccatgcccggggaggacctgaagttcaacctaatcttgcggcagccaatgatcttagagaaaggccagcgtttcaccctgcgagatggcaaccggactattggcaccggtctagtcaccaacacgctggccatgactgaggaggagaagaatatcaaatggggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 20 homolog (S. cerevisiae)
- alkaline phosphatase, placental (Regan isozyme)
- acyl-Coenzyme A dehydrogenase family, member 9
- dihydrouridine synthase 3-like (S. cerevisiae)

Buy TUFM-Tu translation elongation factor, mitochondrial Gene now

Add to cart