Login to display prices
Login to display prices
C1QC-complement component 1, q subcomponent, C chain Gene View larger

C1QC-complement component 1, q subcomponent, C chain Gene

PTXBC009016

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1QC-complement component 1, q subcomponent, C chain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1QC-complement component 1, q subcomponent, C chain Gene

Proteogenix catalog: PTXBC009016
Ncbi symbol: C1QC
Product name: C1QC-complement component 1, q subcomponent, C chain Gene
Size: 2ug
Accessions: BC009016
Gene id: 714
Gene description: complement component 1, q subcomponent, C chain
Synonyms: C1Q-C; C1QG; complement C1q subcomponent subunit C; complement component 1, q subcomponent, C chain; complement component 1, q subcomponent, gamma polypeptide; complement C1q C chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtggggcccagctccctgccccaccttgggctgaagctgctgctgctcctgctgctgctgcccctcaggggccaagccaacacaggctgctacgggatcccagggatgcccggcctgcctggggcaccagggaaggatgggtacgacggactgccggggcccaagggggagccaggaatcccagccattcccgggatccgaggacccaaagggcagaagggagaacccggcttacccggccatcctgggaaaaatggccccatgggaccccctgggatgccaggggtgcccggccccatgggcatccctggagagccaggtgaggagggcagatacaagcagaaattccagtcagtgttcacggtcactcggcagacccaccagccccctgcacccaacagcctgatcagattcaacgcggtcctcaccaacccgcagggagattatgacacgagcactggcaagttcacctgcaaagtccccggcctctactactttgtctaccacgcgtcgcatacagccaacctgtgcgtgctgctgtaccgcagcggcgtcaaagtggtcaccttctgtggccacacgtccaaaaccaatcaggtcaactcgggcggtgtgctgctgaggttgcaggtgggcgaggaggtgtggctggctgtcaatgactactacgacatggtgggcatccagggctctgacagcgtcttctccggcttcctgctcttccccgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: