C1QC-complement component 1, q subcomponent, C chain Gene View larger

C1QC-complement component 1, q subcomponent, C chain Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1QC-complement component 1, q subcomponent, C chain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1QC-complement component 1, q subcomponent, C chain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009016
Product type: DNA & cDNA
Ncbi symbol: C1QC
Origin species: Human
Product name: C1QC-complement component 1, q subcomponent, C chain Gene
Size: 2ug
Accessions: BC009016
Gene id: 714
Gene description: complement component 1, q subcomponent, C chain
Synonyms: C1Q-C; C1QG; complement C1q subcomponent subunit C; complement component 1, q subcomponent, C chain; complement component 1, q subcomponent, gamma polypeptide; complement C1q C chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtggggcccagctccctgccccaccttgggctgaagctgctgctgctcctgctgctgctgcccctcaggggccaagccaacacaggctgctacgggatcccagggatgcccggcctgcctggggcaccagggaaggatgggtacgacggactgccggggcccaagggggagccaggaatcccagccattcccgggatccgaggacccaaagggcagaagggagaacccggcttacccggccatcctgggaaaaatggccccatgggaccccctgggatgccaggggtgcccggccccatgggcatccctggagagccaggtgaggagggcagatacaagcagaaattccagtcagtgttcacggtcactcggcagacccaccagccccctgcacccaacagcctgatcagattcaacgcggtcctcaccaacccgcagggagattatgacacgagcactggcaagttcacctgcaaagtccccggcctctactactttgtctaccacgcgtcgcatacagccaacctgtgcgtgctgctgtaccgcagcggcgtcaaagtggtcaccttctgtggccacacgtccaaaaccaatcaggtcaactcgggcggtgtgctgctgaggttgcaggtgggcgaggaggtgtggctggctgtcaatgactactacgacatggtgggcatccagggctctgacagcgtcttctccggcttcctgctcttccccgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - granzyme H (cathepsin G-like 2, protein h-CCPX)
- Spi-C transcription factor (Spi-1/PU.1 related)
- T-cell activation RhoGTPase activating protein
- capping protein (actin filament), gelsolin-like

Buy C1QC-complement component 1, q subcomponent, C chain Gene now

Add to cart